LOC563403

Ensembl ID:
ENSDARG00000017367
Human Orthologue:
RHBDF1
Human Description:
rhomboid 5 homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:20561]
Mouse Orthologue:
Rhbdf1
Mouse Description:
rhomboid family 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104328]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17176 Essential Splice Site Available for shipment Available now
sa22083 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42017 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42016 Nonsense Mutation detected in F1 DNA During 2016
sa35274 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9498 Nonsense Available for shipment Available now
sa35273 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Essential Splice Site 155 856 3 17
Genomic Location (Zv9):
Chromosome 12 (position 21603590)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20129223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCCTCCWCCTCTATATGTYCCACCGCCACATCATGGCATGCAGAGGG[T/C]AAGCTGAACACATAAAATCNTTTGCTTAAACTWTTCTATTGAAACCRTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Essential Splice Site 224 856 4 17
Genomic Location (Zv9):
Chromosome 12 (position 21601440)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20127073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGTCTGTCGCCAAGATGGGCTTCAGAGCTGCTGCTGCTCTGGTCAAG[G/A]TAATGTGAGGCCATTTGTTAAGCATGTTGCATTAGAACTGTGCATTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Essential Splice Site 224 856 4 17
Genomic Location (Zv9):
Chromosome 12 (position 21601439)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20127072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCTGTCGCCAAGATGGGCTTCAGAGCTGCTGCTGCTCTGGTCAAGG[T/G]AATGTGAGGCCATTTGTTAAGCATGTTGCATTAGAACTGTGCATTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Nonsense 372 856 7 17
Genomic Location (Zv9):
Chromosome 12 (position 21594252)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20119885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATTACTGTGCCTGTTAAAAAACTCTTTGCTAAGGAAAAACGTCCTTA[T/A]GGGCTTGGCATGGTGGGGAAACTGACCAACCGCACCTATCGCAAACGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Essential Splice Site 521 856 11 17
Genomic Location (Zv9):
Chromosome 12 (position 21590981)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20116614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATATCCACTCCAGCTATATTTAACCAAACGTCCTTGTAATTTTCTCA[G/A]AGCACTCTGGCATTATGGGTAAAGTGGCCTCAGCACCCAAGTGCTCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Nonsense 690 856 16 17
Genomic Location (Zv9):
Chromosome 12 (position 21584081)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20109714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCTTCCAGATGACCATTCTAAGGGATTTGGAGAAGCTGGCAGGCTG[G/A]CTGAGAATCTCTATCAKCTATATCCTCAGCGGGATTACGGGCAACCTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040909 Nonsense 849 856 17 17
Genomic Location (Zv9):
Chromosome 12 (position 21579947)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20105580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGTTTCTCACCTGCATCCCGCTGACGGACAAGTTTTGTGAGAAATA[C/A]GACCTCAATGCTCACCTCCACTGAGGCCTTGCAGAAATAGGGCTGCGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link