prdm4

Ensembl ID:
ENSDARG00000017366
ZFIN ID:
ZDB-GENE-041210-131
Description:
PR domain zinc finger protein 4 [Source:RefSeq peptide;Acc:NP_001116215]
Human Orthologue:
PRDM4
Human Description:
PR domain containing 4 [Source:HGNC Symbol;Acc:9348]
Mouse Orthologue:
Prdm4
Mouse Description:
PR domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1920093]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33430 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33429 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110199 Essential Splice Site 442 822 5 10
ENSDART00000147629 Essential Splice Site 443 780 5 11
Genomic Location (Zv9):
Chromosome 4 (position 13987459)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14923312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGAACTGACAGACTGGTCAGACAAGGACACCCCTCAAATATGGAAG[G/A]TCCTTGCAACATATTTCTAAATAAACCTAAACCGCTTAATTCATTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110199 Nonsense 736 822 10 10
ENSDART00000147629 Nonsense 694 780 11 11
Genomic Location (Zv9):
Chromosome 4 (position 13983342)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14919195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAGTGTGACAAGCAGTTCCTAAAGCCTGACCATCTTAAAAAACACT[T/A]AAACTCTCATGAAGGGAAGCGGGACTTCATCTGTGAAAAGTGCAACAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link