NP_001177685.1

Ensembl ID:
ENSDARG00000017360
Description:
collagen type V alpha-3a [Source:RefSeq peptide;Acc:NP_001177685]
Human Orthologue:
COL5A3
Human Description:
collagen, type V, alpha 3 [Source:HGNC Symbol;Acc:14864]
Mouse Orthologue:
Col5a3
Mouse Description:
collagen, type V, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1858212]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26152 Nonsense Mutation detected in F1 DNA During 2017
sa40170 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20148 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa26152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022993 Nonsense 603 1535 29 62
Genomic Location (Zv9):
Chromosome 3 (position 54743712)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53638054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTTTTGTATTTGTTGTTTGCAGGGTGCACGTGGGGGAAGAGGAGCA[C/T]GAGGTCCAACAGGGAAGCCTGGAGCCAAGGTAAGAAATCCATCCTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022993 Essential Splice Site 682 1535 34 62
Genomic Location (Zv9):
Chromosome 3 (position 54746273)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53640179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATTTTTGAGCTGGTTTAATAAAGCTCTCTAAATGATCTCTTATTCC[A/T]GGGCAAAACTGGGGAGACTGGACCCACCGGTGACAGGGGCCACCCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022993 Essential Splice Site 718 1535 35 62
Genomic Location (Zv9):
Chromosome 3 (position 54746608)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53640513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGAGTTGTGGAAACAGAGATCCATCTTTCTGTGTTCTCTGGTCTCC[A/G]GGGAGATCCAGGCCCCGCAGGGCAGCCCGGGAAGAGTGGTCCTGCTGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link