mettl8

Ensembl ID:
ENSDARG00000017359
ZFIN ID:
ZDB-GENE-041114-19
Description:
methyltransferase like 8 [Source:RefSeq peptide;Acc:NP_001007337]
Human Orthologue:
METTL8
Human Description:
methyltransferase like 8 [Source:HGNC Symbol;Acc:25856]
Mouse Orthologue:
Mettl8
Mouse Description:
methyltransferase like 8 Gene [Source:MGI Symbol;Acc:MGI:2385142]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21423 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008606 Essential Splice Site 273 342 8 10
Genomic Location:
Chromosome 9 (position 3526510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGAGACTACGGCAGATACGATCTGTCACAGCTCAGATTTAAGAAAG[G/A]TGATCATCTTGATTGATTTGTCAACTCTGCGTCAGTCTTTTCCTTTAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wghfdl5b