rsph9

Ensembl ID:
ENSDARG00000017355
ZFIN ID:
ZDB-GENE-051120-129
Description:
Radial spoke head protein 9 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5TYW6]
Human Orthologue:
RSPH9
Human Description:
radial spoke head 9 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:21057]
Mouse Orthologue:
Rsph9
Mouse Description:
radial spoke head 9 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1922814]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20196 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010903 Essential Splice Site 76 277 2 5
Genomic Location (Zv9):
Chromosome 4 (position 5523311)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5641492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGAGGCCTACATCAAAGGTTTTCAACATTATTTTTATTCTGATTAC[A/G]GTTTAAACTGCGTAGATTGGCACCTGCTCCCCCCAGCCACCGAGTCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link