epha2

Ensembl ID:
ENSDARG00000017354
ZFIN ID:
ZDB-GENE-990415-63
Description:
ephrin type-A receptor 2 [Source:RefSeq peptide;Acc:NP_571490]
Human Orthologue:
EPHA2
Human Description:
EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
Mouse Orthologue:
Epha2
Mouse Description:
Eph receptor A2 Gene [Source:MGI Symbol;Acc:MGI:95278]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3575 Nonsense Available for shipment Available now
sa1266 Essential Splice Site Available for shipment Available now
sa33949 Nonsense Mutation detected in F1 DNA During 2016
sa40777 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33948 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20802 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
hu3575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 371 984 5 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45825020)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45885954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACGTCACATACAGTGTGGCATGCGAGCGCTGTGAGGGTGGTCTGTG[T/A]ACGCTGTGTGGCGGAAGGGTGCGATTCGAGCCTGCGCAGACGGCCTTGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Essential Splice Site 433 984 6 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45824545)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45885479
KASP Assay ID:
554-1181.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGATGGTTTTAGCCAAAATACTGATGACTGCTTGTGCTTCTGTTGTTC[A/T]GATGGCCCGAGGGTGCTGTACTTGAGAGTTGAAGATCGGACCACCAGYAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 586 984 9 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45821667)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45882601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGAATTCCCACGTCAGACGGAGGGTTGATGGAGATTACTTTTCATG[T/A]CCAGGTATGACATGGATTTTGGCATTTGTGTGCATCTGTTTGGTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Essential Splice Site 629 984 10 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45821391)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45882325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAGATTCATCCTGGTCACATCACCAAGCAGAAAGTCATTGGTGCAG[G/A]TCAGTGTTCATATTGTGTTAGCCGTATGGTATATTAATAGTATACATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Essential Splice Site 832 984 14 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45816071)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45877005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGATGTCATTTGGAGAAAGACCCTACTGGGACATGAGCAACCAAGAGG[T/C]ATGGAGTGTTACTTATGTTTTTTTGATCGATGGCTATACATCAAAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 970 984 17 17
ENSDART00000136964   None 52 None 2
Genomic Location (Zv9):
Chromosome 6 (position 45812399)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45873333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGAGTTCGGCTGGCAGGTCATCAGAAGAGAATAGCATACAGCATTT[T/A]GGGCCTGCAAGACCCAGTGGGGGCCTTGGATTTGTTTGCAATGTGATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link