epha2

Ensembl ID:
ENSDARG00000017354
ZFIN ID:
ZDB-GENE-990415-63
Description:
ephrin type-A receptor 2 [Source:RefSeq peptide;Acc:NP_571490]
Human Orthologue:
EPHA2
Human Description:
EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
Mouse Orthologue:
Epha2
Mouse Description:
Eph receptor A2 Gene [Source:MGI Symbol;Acc:MGI:95278]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3575 Nonsense Confirmed mutation in F2 line Unknown
sa1266 Essential Splice Site Available for shipment Available now
sa8243 Nonsense Mutation detected in F1 DNA During 2014
sa20802 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu3575
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 371 984 5 17
ENSDART00000136964 None None 52 None 2
Genomic Location:
Chromosome 6 (position 45825020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACGTCACATACAGTGTGGCATGCGAGCGCTGTGAGGGTGGTCTGTG[T/A]ACGCTGTGTGGCGGAAGGGTGCGATTCGAGCCTGCGCAGACGGCCTTGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Essential Splice Site 433 984 6 17
ENSDART00000136964 None None 52 None 2
Genomic Location:
Chromosome 6 (position 45824545)
KASP Assay ID:
554-1181.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGATGGTTTTAGCCAAAATACTGATGACTGCTTGTGCTTCTGTTGTTC[A/T]GATGGCCCGAGGGTGCTGTACTTGAGAGTTGAAGATCGGACCACCAGYAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 452 984 6 17
ENSDART00000136964 None None 52 None 2
Genomic Location:
Chromosome 6 (position 45824486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGTGCTGTACTTGAGAGTTGAAGATCGGACCACCAGYAGTCTGACYT[T/A]GTCCTGGGCTKTGGACCAWCATGTGCAGAAWCAACCCTCCCCTCGCTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025428 Nonsense 970 984 17 17
ENSDART00000136964 None None 52 None 2
Genomic Location:
Chromosome 6 (position 45812399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGGAGTTCGGCTGGCAGGTCATCAGAAGAGAATAGCATACAGCATTT[T/A]GGGCCTGCAAGACCCAGTGGGGGCCTTGGATTTGTTTGCAATGTGATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/upxko2vg