kidins220b

Ensembl ID:
ENSDARG00000017338
ZFIN ID:
ZDB-GENE-030131-7824
Description:
Kinase D-interacting substrate of 220 kDa [Source:UniProtKB/Swiss-Prot;Acc:Q7T163]
Human Orthologue:
KIDINS220
Human Description:
kinase D-interacting substrate, 220kDa [Source:HGNC Symbol;Acc:29508]
Mouse Orthologue:
Kidins220
Mouse Description:
kinase D-interacting substrate 220 Gene [Source:MGI Symbol;Acc:MGI:1924730]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43464 Nonsense Mutation detected in F1 DNA During 2017
sa43465 Nonsense Mutation detected in F1 DNA During 2017
sa43466 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 976 1672 22 28
ENSDART00000101603 Nonsense 984 1731 21 29
ENSDART00000146366 Nonsense 984 1680 22 28
Genomic Location (Zv9):
Chromosome 20 (position 29793333)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29864546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGGACCGGCTCGCATCTTGGATCAACCTGACTGAGCAGTGGCCGTA[T/A]CGCACCTCCTGGCTCATACTCTACCTAGAAGAGACCGATGGCATCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 1192 1672 26 28
ENSDART00000101603 Nonsense 1251 1731 27 29
ENSDART00000146366 Nonsense 1200 1680 26 28
Genomic Location (Zv9):
Chromosome 20 (position 29805934)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29877147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGTGATTTTTTTTTTTCAGGCTAACATAAATGGCCGAGTTCTGTCT[C/T]AGTGCAACATTGATGAGCTGAAGAAAGAGATGAACATGAATTTTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 1510 1672 28 28
ENSDART00000101603 Nonsense 1569 1731 29 29
ENSDART00000146366 Nonsense 1518 1680 28 28
Genomic Location (Zv9):
Chromosome 20 (position 29808305)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29879518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGACTCTGGTGTCCGCTCCAACGAAAGCTCACCTAACCATTCGCTA[C/T]AAGACGAAGAGGCTGATCTGTCACAATCAGAGAGGGCTAACCTGATCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link