cdkl1

Ensembl ID:
ENSDARG00000017329
ZFIN ID:
ZDB-GENE-040808-34
Description:
Cyclin-dependent kinase-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6AXJ9]
Human Orthologue:
CDKL1
Human Description:
cyclin-dependent kinase-like 1 (CDC2-related kinase) [Source:HGNC Symbol;Acc:1781]
Mouse Orthologue:
Cdkl1
Mouse Description:
cyclin-dependent kinase-like 1 (CDC2-related kinase) Gene [Source:MGI Symbol;Acc:MGI:1918341]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38962 Nonsense Mutation detected in F1 DNA During 2017
sa31949 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044357 Nonsense 227 350 7 10
Genomic Location (Zv9):
Chromosome 13 (position 37097595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36569897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATGGTTTAATGTTGTGCTCATAGGTGAGTTGATTCCTCGACATCAA[C/T]AGGTGTTCAGCACCAACCAGTTCTTTAGCGGCGTTTGTGTGCCTGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044357 Nonsense 284 350 9 10
Genomic Location (Zv9):
Chromosome 13 (position 37097260)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36569562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCGGATGGATCCGGCTGAGAGGTTGTCCTGTGAGCAGTTACTGGAA[C/T]AGCCCTACTTTGACAGTCTGCGAGAGGAGAGCGAGAGTGTGACGCGTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link