kdr

Ensembl ID:
ENSDARG00000017321
ZFIN ID:
ZDB-GENE-041001-112
Description:
Vascular endothelial growth factor receptor 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5GIT4]
Human Orthologue:
KDR
Human Description:
kinase insert domain receptor (a type III receptor tyrosine kinase) [Source:HGNC Symbol;Acc:6307]
Mouse Orthologue:
Kdr
Mouse Description:
kinase insert domain protein receptor Gene [Source:MGI Symbol;Acc:MGI:96683]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13239 Nonsense Available for shipment Available now
sa43425 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43426 Nonsense Mutation detected in F1 DNA During 2016
sa23684 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Nonsense 121 1357 3 30
Genomic Location:
Chromosome 20 (position 22304991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTATAAGAGCMTGCCAAAAGAGGATGGGAARACATCTGWAGCTGTATA[T/A]GTCTTCATACAAGGTATCATTGTCATGTCGGAAAAGTTTTAAGACAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Essential Splice Site 268 1357 6 30
Genomic Location:
Chromosome 20 (position 22309482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTCAATGTTGGAATCGACTTCCAGTGGACCTTCCCTCATGAGAAGG[T/C]CAGTAATGGAGAGAAATGCCCAGAGTTCAGTCATTTTTACCTCTGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Nonsense 586 1357 13 30
Genomic Location:
Chromosome 20 (position 22326174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAAGGACAGGATGTTATAATGCGTTGTGTAGCAGACCGGCTGCTGTA[C/A]TATAACTTGCGCTGGTATCGGGTAGCAAATGTAGCCAACCATGATCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Nonsense 1131 1357 25 30
Genomic Location:
Chromosome 20 (position 22344186)
KASP Assay ID:
2261-4232.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCATATCCAGGTGTGTGCATTGATGAGTCTTTCTGCAGGCGACTT[A/T]AAGAGGGAACCAGAATGAGAGCTCCAGATTACGCCACGCCTGAAATGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link