kdr

Ensembl ID:
ENSDARG00000017321
ZFIN ID:
ZDB-GENE-041001-112
Description:
Vascular endothelial growth factor receptor 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5GIT4]
Human Orthologue:
KDR
Human Description:
kinase insert domain receptor (a type III receptor tyrosine kinase) [Source:HGNC Symbol;Acc:6307]
Mouse Orthologue:
Kdr
Mouse Description:
kinase insert domain protein receptor Gene [Source:MGI Symbol;Acc:MGI:96683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13239 Nonsense Available for shipment Available now
sa23684 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Nonsense 121 1357 3 30
Genomic Location:
Chromosome 20 (position 22304991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTATAAGAGCMTGCCAAAAGAGGATGGGAARACATCTGWAGCTGTATA[T/A]GTCTTCATACAAGGTATCATTGTCATGTCGGAAAAGTTTTAAGACAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049204 Nonsense 1131 1357 25 30
Genomic Location:
Chromosome 20 (position 22344186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCATATCCAGGTGTGTGCATTGATGAGTCTTTCTGCAGGCGACTT[A/T]AAGAGGGAACCAGAATGAGAGCTCCAGATTACGCCACGCCTGAAATGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/87cunoca