bag5

Ensembl ID:
ENSDARG00000017316
ZFIN ID:
ZDB-GENE-050913-58
Description:
BAG family molecular chaperone regulator 5 [Source:RefSeq peptide;Acc:NP_001029355]
Human Orthologue:
BAG5
Human Description:
BCL2-associated athanogene 5 [Source:HGNC Symbol;Acc:941]
Mouse Orthologue:
Bag5
Mouse Description:
BCL2-associated athanogene 5 Gene [Source:MGI Symbol;Acc:MGI:1917619]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13093 Essential Splice Site Available for shipment Available now
sa12658 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010286 Essential Splice Site 297 471 4 6
ENSDART00000124688 Essential Splice Site 337 511 4 5
ENSDART00000145914 Essential Splice Site 320 494 4 5
ENSDART00000010286 Essential Splice Site 297 471 4 6
ENSDART00000124688 Essential Splice Site 337 511 4 5
ENSDART00000145914 Essential Splice Site 320 494 4 5
Genomic Location:
Chromosome 13 (position 15725015)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTGTTGAAACATCTTGACCTGGAGGGTGAAGGAGAAGACACACACAG[G/A]TGATACTAAACACACACATCAACACACAAACTACAACAGCTGTGCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010286 Essential Splice Site 297 471 4 6
ENSDART00000124688 Essential Splice Site 337 511 4 5
ENSDART00000145914 Essential Splice Site 320 494 4 5
ENSDART00000010286 Essential Splice Site 297 471 4 6
ENSDART00000124688 Essential Splice Site 337 511 4 5
ENSDART00000145914 Essential Splice Site 320 494 4 5
Genomic Location:
Chromosome 13 (position 15725015)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTGTTGAAACATCTTGACCTGGAGGGTGAAGGAGAAGACACACACAG[G/A]TGATACTAAACACACACATCAACACACAAACTACAACAGCTGTGCCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x0vek28p