larp7

Ensembl ID:
ENSDARG00000017315
ZFIN ID:
ZDB-GENE-030131-6896
Description:
La-related protein 7 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWE3]
Human Orthologue:
LARP7
Human Description:
La ribonucleoprotein domain family, member 7 [Source:HGNC Symbol;Acc:24912]
Mouse Orthologues:
Gm12666, Larp7
Mouse Descriptions:
La ribonucleoprotein domain family, member 7 Gene [Source:MGI Symbol;Acc:MGI:107634]
predicted gene 12666 Gene [Source:MGI Symbol;Acc:MGI:3650864]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21105 Nonsense Mutation detected in F1 DNA During 2014
sa14775 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008554 Nonsense 373 555 9 13
ENSDART00000101731 Nonsense 373 555 9 13
Genomic Location:
Chromosome 7 (position 60052636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCTTTTTCAAATATCAGGAAGGAGTGGTTGGACCTGAAGCAAGAGTA[T/A]CTCACACTGCAGAAGCGCTGCATGGCCCATCTGAAGCAGTCAGTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008554 Nonsense 425 555 10 13
ENSDART00000101731 Nonsense 425 555 10 13
Genomic Location:
Chromosome 7 (position 60052401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCWTAAAGTTTATAAAGATACACCTAAGAAAGAGCTCACTTCTGGTCCT[G/T]AGTTTTTAAGTGGTGTCATTGTCAAGATTAGCTATAMCCAACCTCTGCCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t5x5uyzu