lmbrd2b

Ensembl ID:
ENSDARG00000017312
ZFIN ID:
ZDB-GENE-030131-7197
Description:
LMBR1 domain-containing protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:Q6P4P2]
Human Orthologue:
LMBRD2
Human Description:
LMBR1 domain containing 2 [Source:HGNC Symbol;Acc:25287]
Mouse Orthologue:
Lmbrd2
Mouse Description:
LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18217 Essential Splice Site Available for shipment Available now
sa8907 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10053 Essential Splice Site Available for shipment Available now
sa23925 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
Genomic Location:
Chromosome 21 (position 21364480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTCTGYCATATCCCACCAAGCAAAGAAGCAGAMRGCATACACCTCTG[T/A]GAGTCTTTCAGCATTATGTACGATKATTTTAATATGCYAGCAAAAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
Genomic Location:
Chromosome 21 (position 21364480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTCTGYCATATCCCACCAAGCAAAGAAGCAGACRGCATACACCTCTG[T/A]GAGTCTTTCAGCATTATGTACGATKATTTTAATATGCYAGCAAAAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
ENSDART00000021682 Essential Splice Site 520 704 12 18
ENSDART00000134592 Essential Splice Site 552 736 12 18
Genomic Location:
Chromosome 21 (position 21364480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTCTGYCATATCCCACCAAGCAAAGAAGCAGACRGCATACACCTCTG[T/A]GAGTCTTTCAGCATTATGTACGATKATTTTAATATGCYAGCAAAAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021682 Nonsense 647 704 17 18
ENSDART00000134592 Nonsense 679 736 17 18
Genomic Location:
Chromosome 21 (position 21372542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGCACCCTAAGTGATTTTTTTTTTCCCCACAGAGGCAAAGTACACA[C/T]GAAGTGGCAGCCAATCAGGACGAGACAGCATTGAGTTGTTACAAGATGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y80mt02f