gpsm2

Ensembl ID:
ENSDARG00000017311
ZFIN ID:
ZDB-GENE-040426-1169
Description:
G-protein-signaling modulator 2 [Source:RefSeq peptide;Acc:NP_956732]
Human Orthologue:
GPSM2
Human Description:
G-protein signaling modulator 2 [Source:HGNC Symbol;Acc:29501]
Mouse Orthologue:
Gpsm2
Mouse Description:
G-protein signalling modulator 2 (AGS3-like, C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1923373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25906 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024034 Missense 564 649 14 15
ENSDART00000056357 Missense 563 647 16 19
ENSDART00000110108 Essential Splice Site 563 645 None 18
ENSDART00000113058 Missense 585 670 13 14
ENSDART00000131412   None 83 None 3
ENSDART00000145634   None 151 None 6

The following transcripts of ENSDARG00000017311 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 45547628)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45639290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGAGGGCAGGAACGGGGAACAGTTTGCCTGGCCTGCGCACCCTGAA[T/A]GAACACAGCAGCACCAACAACAGACAGATGATCCTCAGCCAGGTCATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link