gnai2

Ensembl ID:
ENSDARG00000017294
ZFIN IDs:
ZDB-GENE-030131-5861, ZDB-GENE-030131-5861
Description:
guanine nucleotide-binding protein G(i) subunit alpha-2 [Source:RefSeq peptide;Acc:NP_956136]
Human Orthologue:
GNAI2
Human Description:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 [Source:HGNC
Mouse Orthologue:
Gnai2
Mouse Description:
guanine nucleotide binding protein (G protein), alpha inhibiting 2 Gene [Source:MGI Symbol;Acc:MGI:9

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33975 Essential Splice Site, Missense Available for shipment Available now
sa33974 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024181 Missense 1 322 1 9
ENSDART00000079694 Essential Splice Site 26 349 None 10
Genomic Location (Zv9):
Chromosome 6 (position 53096256)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 53145261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCGGCCGCAGAGAGATCAAAGATGATCGACAAAAACCTGCGGGAGGA[T/A]GGAGAGAAGGCGGCGAGGGAGGTGAAGCTGCTCCTGCTCGGTAAGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024181 Nonsense 263 322 8 9
ENSDART00000079694 Nonsense 290 349 9 10
Genomic Location (Zv9):
Chromosome 6 (position 53005412)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 53054417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCACAAGTTCAAATCGATTTTCTGTATTTTGTTGATGCAGGAGCCAAT[A/T]AATACGACGAGGCTGCCAGTTACATCCAGACCAAGTTCGAGGATCTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link