si:ch211-14c7.3

Ensembl ID:
ENSDARG00000017246
ZFIN ID:
ZDB-GENE-030131-5790
Description:
Novel protein similar to vertebrate periaxin (PRX) [Source:UniProtKB/TrEMBL;Acc:Q1L8A1]
Human Orthologues:
AHNAK2, PRX
Human Descriptions:
AHNAK nucleoprotein 2 [Source:HGNC Symbol;Acc:20125]
periaxin [Source:HGNC Symbol;Acc:13797]
Mouse Orthologues:
Ahnak2, Prx
Mouse Descriptions:
AHNAK nucleoprotein 2 Gene [Source:MGI Symbol;Acc:MGI:2144831]
periaxin Gene [Source:MGI Symbol;Acc:MGI:108176]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36730 Nonsense Mutation detected in F1 DNA During 2017
sa32221 Nonsense Available for shipment Available now
sa43175 Nonsense Mutation detected in F1 DNA During 2017
sa36729 Nonsense Mutation detected in F1 DNA During 2017
sa36728 Nonsense Mutation detected in F1 DNA During 2017
sa23379 Nonsense Available for shipment Available now
sa23378 Nonsense Available for shipment Available now
sa43174 Nonsense Mutation detected in F1 DNA During 2017
sa31028 Nonsense Mutation detected in F1 DNA During 2017
sa43173 Nonsense Mutation detected in F1 DNA During 2017
sa18071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 141 4197 4 4
ENSDART00000134244   None 84 5 5
ENSDART00000145999 Nonsense 141 149 7 7
Genomic Location (Zv9):
Chromosome 18 (position 44631836)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46225365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAATGATAACCTTTTTCTTGCAGAGCGTCAAAAGTGTGAAACCATTC[A/T]AAACCAAGAAAAGGAGAGGAGGAAGATTTGGATTGAAAAGACTGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 1190 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44628689)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46222218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGATATCTCTCTACCAGGAGGTAAAGCTGGAGGTAATGTAGATGTC[A/T]AAGCTCATGGAGGACAAGGAGAAAAATTTGAAATGCCAAAATTGGATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 1210 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44628629)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46222158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACAAGGAGAAAAATTTGAAATGCCAAAATTGGATGTCTCCTTGCCC[A/T]AATTAAAAACATCAGGAGGTGAAATCAACATTGAAGGTCCCGATATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 1380 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44628119)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46221648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGAGCAGAAGGTGATGTAGATGTTGAAGGACATGGTGGAAAATTT[G/T]AAATGCCCAAATTTGATATTTCCATGCCTAAATTTAAACCATCTGGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 1733 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44627060)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46220589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGATATCTCTCTACCAAAAGGTGGAGCAGGAGGTGATGTAGGTGTC[A/T]AAGCTCATGGAGGAAAAGGAGGAAAATTTGAAATGCCCAAATTGGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 2359 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44625182)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46218711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGGAAAATTTGAAATGCCAAAATTGGATGTCTCCTTGCCTAAATTA[A/T]AACCATCAGGAGGTGAAATCAACATGAAAGGTCCAGACATCGAAAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 2961 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44623376)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46216905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTAAAAGGAGGACAATTTGAAATGCCAAAATTGGATGTTTCCTTGCCC[A/T]AATTAAAACCATCAGGAGGTGAAATCAACATTGAAGGTCCCGATATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 2963 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44623370)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46216899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGGACAATTTGAAATGCCAAAATTGGATGTTTCCTTGCCCAAATTA[A/T]AACCATCAGGAGGTGAAATCAACATTGAAGGTCCCGATATCGAAAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 3275 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44622434)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46215963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATCTGGATCAAGTTTTGATGTTCCAGAGGTCTCTTTAAAATTGCCC[A/T]AGATTTCCCTCCCAAAATTTGGCAGAAAATTAAAAAGTGGAGACAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 3698 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44621165)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46214694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAATAACAATGCCTAAAGTGGATATATCATTACCGCATCATTACCCC[A/T]AAACAGTTGACCCTGAGGCTTCAGGATCTGTGGGAGTAGACACTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059039 Nonsense 4044 4197 4 4
ENSDART00000134244   None 84 None 5
ENSDART00000145999   None 149 None 7
Genomic Location (Zv9):
Chromosome 18 (position 44620126)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46213655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAGACCTCATGGGAACTCAAAGAGACCAAGGAGACAAAGACGAYAT[C/A]AAGCACAATGTCTTTCCCAGGTCTTAAGAAGAAACCAGGGAAGGAYGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link