CHD6

Ensembl ID:
ENSDARG00000017244
Description:
chromodomain helicase DNA binding protein 6 [Source:HGNC Symbol;Acc:19057]
Human Orthologue:
CHD6
Human Description:
chromodomain helicase DNA binding protein 6 [Source:HGNC Symbol;Acc:19057]
Mouse Orthologue:
Chd6
Mouse Description:
chromodomain helicase DNA binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:1918639]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10755 Nonsense Available for shipment Available now
sa3610 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17547 Essential Splice Site Available for shipment Available now
sa3598 Nonsense Mutation detected in F1 DNA During 2014
sa2320 Essential Splice Site F2 line generated During 2014
sa20819 Nonsense Mutation detected in F1 DNA During 2014
sa8246 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 244 1642 7 33
Genomic Location:
Chromosome 6 (position 51581941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTGTGCAGAAGAGGCGATCAGGGCGTCAAGTGAAGCGGCGGAAGTA[T/A]AACGAAGATCTTGATTTCAAGGTKRYGGATGATGACGGGGAGACCATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 436 1642 12 33
Genomic Location:
Chromosome 6 (position 51576091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCAAAGAGTTCGAAGAGCTCAAGAAAGTTCCTGAAATGAAGCATGTG[G/A]TAAGTCCTTGACTTCAAATAGAGCTGGTGTTTCCTCGTAACAYGATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 477 1642 13 33
Genomic Location:
Chromosome 6 (position 51575784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACCAGYTAGAGGGAAYGAACTGGCTGCTTTTCAACTGGTACAACAG[G/T]TAAAAAAGAAGATATTAGGGYTCACATTAATGTTTGAGYCTATTTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 537 1642 14 33
Genomic Location:
Chromosome 6 (position 51573185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGGAGAGAGAGTTTCGCACCTGGACTGAAATGAACGTCATCGTCTA[T/A]CACGGCAGCCAGATCAGCCGGCAGATGATCCTGCAGTACGAGATRTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2320
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 1452 1642 32 33
Genomic Location:
Chromosome 6 (position 51547177)
KASP Assay ID:
554-3298.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCATATTTAGGAWTTGTTTTACTGTAATCACATATCTTCTTTAAAAC[A/T]GGTGGACACGTCGTGAGCAGGCTGACTTCTAYCGTACAGTGTCCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 1625 1642 33 33
Genomic Location:
Chromosome 6 (position 51546572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATCCTTCCTGGAGGCCCACCGGAACTATGTTCATAAAGAAAACCAC[A/T]GATATCCAGTCCCAGGATTGCCCCACCATCATTGCTGCTTATATGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 1626 1642 33 33
Genomic Location:
Chromosome 6 (position 51546567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCCTGGAGGCCCACCGGAACTATGTTCATAAAGAAAACCACAGATA[T/A]CCAGTCCCAGGATTGCCCCACCATCATTGCTGCTTATATGATGCCAACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dmy34nep