CHD6

Ensembl ID:
ENSDARG00000017244
Description:
chromodomain helicase DNA binding protein 6 [Source:HGNC Symbol;Acc:19057]
Human Orthologue:
CHD6
Human Description:
chromodomain helicase DNA binding protein 6 [Source:HGNC Symbol;Acc:19057]
Mouse Orthologue:
Chd6
Mouse Description:
chromodomain helicase DNA binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:1918639]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33968 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10755 Nonsense Available for shipment Available now
sa17547 Essential Splice Site Available for shipment Available now
sa2320 Essential Splice Site F2 line generated During 2016
sa20819 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 145 1642 3 33
Genomic Location (Zv9):
Chromosome 6 (position 51589040)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51638222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGGTCAAAAAGGTCAAAAAAGGTCAAGATGTGAAGGTGAAAACGC[T/C]GGCTAAAAACCAGTGTGCGACACATACGCCCTCCAAGAGAGGGAGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 244 1642 7 33
Genomic Location (Zv9):
Chromosome 6 (position 51581941)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51631123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTGTGCAGAAGAGGCGATCAGGGCGTCAAGTGAAGCGGCGGAAGTA[T/A]AACGAAGATCTTGATTTCAAGGTKRYGGATGATGACGGGGAGACCATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 477 1642 13 33
Genomic Location (Zv9):
Chromosome 6 (position 51575784)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51624966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACCAGYTAGAGGGAAYGAACTGGCTGCTTTTCAACTGGTACAACAG[G/T]TAAAAAAGAAGATATTAGGGYTCACATTAATGTTTGAGYCTATTTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2320
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Essential Splice Site 1452 1642 32 33
Genomic Location (Zv9):
Chromosome 6 (position 51547177)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51596359
KASP Assay ID:
554-3298.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCATATTTAGGAWTTGTTTTACTGTAATCACATATCTTCTTTAAAAC[A/T]GGTGGACACGTCGTGAGCAGGCTGACTTCTAYCGTACAGTGTCCTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028607 Nonsense 1625 1642 33 33
Genomic Location (Zv9):
Chromosome 6 (position 51546572)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51595754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATCCTTCCTGGAGGCCCACCGGAACTATGTTCATAAAGAAAACCAC[A/T]GATATCCAGTCCCAGGATTGCCCCACCATCATTGCTGCTTATATGATGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link