megf10

Ensembl ID:
ENSDARG00000017229
ZFIN IDs:
ZDB-GENE-030131-3302, ZDB-GENE-080506-1
Human Orthologue:
MEGF10
Human Description:
multiple EGF-like-domains 10 [Source:HGNC Symbol;Acc:29634]
Mouse Orthologue:
Megf10
Mouse Description:
multiple EGF-like-domains 10 Gene [Source:MGI Symbol;Acc:MGI:2685177]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13029 Nonsense Available for shipment Available now
sa21693 Nonsense Mutation detected in F1 DNA During 2014
sa6165 Nonsense Mutation detected in F1 DNA During 2014
sa6166 Essential Splice Site Confirmed mutation in F2 line During 2014
sa4365 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 110 1119 5 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 16129082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCTTACTCTCTCTTGTTTTCGCTGTAGCCCACTGTGCTGAGAAATG[T/A]GTGCATGGCCGCTGCGTGGCCCCCAACACCTGTCAGTGTGAGCCGGGCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 215 1119 6 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 16137788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATGCCACCACATCACAGGCGAATGCGTGTGCAGTCCAGGATACACA[G/T]GAGCATTGTAAGTTTACCTGCATTTTTTTTTGCAAACAATAGAAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 277 1119 8 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 16138287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAACCCTGTCCGACGGGACGCTTTGGTAAGAACTGCTCACAGGAGTG[T/A]CAGTGTCWTAATGGAGGAATCTGTTCGCCATCCACAGGACAGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6166
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 373 1119 9 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 16146816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTAAGTGTGACAGGAAGTGCCCATGTAACACCAACAACACACGCAG[G/A]TGAGACAAACACTGCAAATATGTTTTCATCTTTTCAGTACTTACATGGCG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
degenerate
PATO:0000639
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa4365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 744 1119 18 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 16175509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACATTTGGTCATGGCATTTCCTGTCTTCTTGTCCTGCAGGATGTCCAT[T/A]GGGTTTCTATGGTAAGGATTGTGTGCAGGCATGTCAATGTGAGAATGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hsrtqkyi