otud7b

Ensembl ID:
ENSDARG00000017220
ZFIN ID:
ZDB-GENE-060616-1
Description:
OTU domain-containing protein 7B [Source:RefSeq peptide;Acc:NP_001071212]
Human Orthologue:
OTUD7B
Human Description:
OTU domain containing 7B [Source:HGNC Symbol;Acc:16683]
Mouse Orthologue:
Otud7b
Mouse Description:
OTU domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2654703]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22940 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041811 Essential Splice Site 237 917 6 12
ENSDART00000124689 Essential Splice Site 238 545 6 12
ENSDART00000128840 Essential Splice Site 238 920 5 11
Genomic Location:
Chromosome 16 (position 49035253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTTTAAAGCGAAGGTGGAGATGGCAGCAAACCATGCAGAACAAAGAG[G/A]TTGGATCAGTTTATCTGTTAATTCATTATTTTGTACAAAACCCAAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041811 Nonsense 282 917 8 12
ENSDART00000124689 Nonsense 283 545 8 12
ENSDART00000128840 Nonsense 283 920 7 11
Genomic Location:
Chromosome 16 (position 49035956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGTGTGTTGCGTCCCGCAGTGCCGAATCGCAGGAGGAGCCRGTGTA[T/A]GAGAGCCTGGAGGAGTTTCATGTGTTCGTTCTTGCTCACGTGCTCCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mj6dcfo1