otud7b

Ensembl ID:
ENSDARG00000017220
ZFIN ID:
ZDB-GENE-060616-1
Description:
OTU domain-containing protein 7B [Source:RefSeq peptide;Acc:NP_001071212]
Human Orthologue:
OTUD7B
Human Description:
OTU domain containing 7B [Source:HGNC Symbol;Acc:16683]
Mouse Orthologue:
Otud7b
Mouse Description:
OTU domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2654703]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42813 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22940 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041811 Essential Splice Site 86 917 3 12
ENSDART00000124689 Essential Splice Site 86 545 3 12
ENSDART00000128840 Essential Splice Site 86 920 2 11
Genomic Location (Zv9):
Chromosome 16 (position 49030081)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45999302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGGACAGGACGGCCCCTCTTACATCGACAAGATGAGGCTGTTCAAGG[T/C]AAGACTGTAAAATATTGTTTCGGCATTGATATTGCTGTGTGCACATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041811 Essential Splice Site 237 917 6 12
ENSDART00000124689 Essential Splice Site 238 545 6 12
ENSDART00000128840 Essential Splice Site 238 920 5 11
Genomic Location (Zv9):
Chromosome 16 (position 49035253)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46004474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTTTAAAGCGAAGGTGGAGATGGCAGCAAACCATGCAGAACAAAGAG[G/A]TTGGATCAGTTTATCTGTTAATTCATTATTTTGTACAAAACCCAAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041811 Nonsense 282 917 8 12
ENSDART00000124689 Nonsense 283 545 8 12
ENSDART00000128840 Nonsense 283 920 7 11
Genomic Location (Zv9):
Chromosome 16 (position 49035956)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46005177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGTGTGTTGCGTCCCGCAGTGCCGAATCGCAGGAGGAGCCRGTGTA[T/A]GAGAGCCTGGAGGAGTTTCATGTGTTCGTTCTTGCTCACGTGCTCCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link