pabpc1a

Ensembl ID:
ENSDARG00000017219
ZFIN ID:
ZDB-GENE-030131-3238
Description:
poly A binding protein, cytoplasmic 1 a [Source:RefSeq peptide;Acc:NP_001026846]
Human Orthologues:
PABPC1, PABPC3
Human Descriptions:
poly(A) binding protein, cytoplasmic 1 [Source:HGNC Symbol;Acc:8554]
poly(A) binding protein, cytoplasmic 3 [Source:HGNC Symbol;Acc:8556]
Mouse Orthologues:
Pabpc1, Pabpc2, Pabpc6
Mouse Descriptions:
poly(A) binding protein, cytoplasmic 1 Gene [Source:MGI Symbol;Acc:MGI:1349722]
poly(A) binding protein, cytoplasmic 2 Gene [Source:MGI Symbol;Acc:MGI:1349723]
poly(A) binding protein, cytoplasmic 6 Gene [Source:MGI Symbol;Acc:MGI:1914793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39135 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024729 Nonsense 608 634 14 15
Genomic Location (Zv9):
Chromosome 16 (position 58374519)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55142375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTGTACGCTCCTCTGGTTAATACTGATGTGTGTGTTCCAGGTGGAT[G/T]AAGCAGTAGCAGTGCTGCAGGCTCACCAGGCCAAAGAAGCAGCACAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link