sc:d812

Ensembl ID:
ENSDARG00000017217
ZFIN ID:
ZDB-GENE-080303-21
Description:
cDNA, clone cssl:d0812 [Source:UniProtKB/TrEMBL;Acc:A4JYF4]
Human Orthologues:
C1orf204, IGSF11
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
immunoglobulin superfamily, member 11 [Source:HGNC Symbol;Acc:16669]
Mouse Orthologue:
Igsf11
Mouse Description:
immunoglobulin superfamily, member 11 Gene [Source:MGI Symbol;Acc:MGI:2388477]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1863 Essential Splice Site F2 line generated During 2017
sa42630 Nonsense Mutation detected in F1 DNA During 2017
sa19127 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1863
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099202 Essential Splice Site 21 442 2 7
Genomic Location (Zv9):
Chromosome 15 (position 45907556)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46329579
KASP Assay ID:
554-1854.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCATGCATTTATTTGACTATGTGWATATGTGTGTGTTTTCTCTGC[A/T]GTGTGTGTGTATGCGCTAGAAGTGACGGTCAGTCAGAGCAGTGTCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099202 Nonsense 24 442 2 7
Genomic Location (Zv9):
Chromosome 15 (position 45907568)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46329591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTTGACTATGTGTATATGTGTGTGTTTTCTCTGCAGTGTGTGTGTA[T/A]GCGCTAGAAGTGACGGTCAGTCAGAGCAGTGTCCAGGTGGCCAGAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099202 Essential Splice Site 76 442 3 7
Genomic Location (Zv9):
Chromosome 15 (position 45926875)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46348808
KASP Assay ID:
2260-9038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTC[A/G]GGTGATCATCTACCAGAGTGGTCAGGTATTCAGTTTAGCCAATCACATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link