prss35

Ensembl ID:
ENSDARG00000017213
ZFIN ID:
ZDB-GENE-040704-55
Description:
protease, serine, 35 [Source:RefSeq peptide;Acc:NP_001002212]
Human Orthologue:
PRSS35
Human Description:
protease, serine, 35 [Source:HGNC Symbol;Acc:21387]
Mouse Orthologue:
Prss35
Mouse Description:
protease, serine, 35 Gene [Source:MGI Symbol;Acc:MGI:2444800]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42768 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003552 Nonsense 401 418 2 2
Genomic Location (Zv9):
Chromosome 16 (position 35317556)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33049901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGGCAGCAGGATTACAACGTGGCTGTCCGAATCACACCTCTAAAGTA[C/A]GCACAGATCTGCCGCTGGGTCCATGGAGACTCCAGCCAGTGTCGGGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link