plxnb1b

Ensembl ID:
ENSDARG00000017211
ZFIN ID:
ZDB-GENE-090812-4
Description:
Plexin B1b [Source:UniProtKB/TrEMBL;Acc:B6E523]
Human Orthologue:
PLXNB1
Human Description:
plexin B1 [Source:HGNC Symbol;Acc:9103]
Mouse Orthologue:
Plxnb1
Mouse Description:
plexin B1 Gene [Source:MGI Symbol;Acc:MGI:2154238]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9253 Nonsense Mutation detected in F1 DNA During 2017
sa33867 Nonsense Mutation detected in F1 DNA During 2017
sa12455 Nonsense Available for shipment Available now
sa20697 Nonsense Available for shipment Available now
sa17905 Nonsense Available for shipment Available now
sa31510 Nonsense Available for shipment Available now
sa16675 Essential Splice Site Available for shipment Available now
sa40688 Nonsense Mutation detected in F1 DNA During 2017
sa33866 Nonsense Available for shipment Available now
sa20696 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 116 2220 1 36
Genomic Location (Zv9):
Chromosome 6 (position 23630836)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19886282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGACCAATAACCACAACAAGCTACTACTTGTGGATCCTTACAGTCAG[C/T]AACTCATCAGCTGTGGAAGTGTTCATCAAGGAATATGTCAGAAACGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 258 2220 1 36
Genomic Location (Zv9):
Chromosome 6 (position 23630409)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19885855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAAGTCACAATCGAGGGAATATCGCACATATGTTTCCCGTATGTGTT[T/A]GGATGACACTGCGTATTATTCTTATGTTGAAGTTCCATTAAGTTGCCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1028 2220 10 36
Genomic Location (Zv9):
Chromosome 6 (position 23610795)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19866241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAACTCAGAGAAAAATCTCTCTGCTGGCTCGCAACTTGCAGCTCTAT[C/T]AGGTAACAACAAAAAAACACCCACTTCTCTCTGATATAAAAAAAANTNNC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1034 2220 11 36
Genomic Location (Zv9):
Chromosome 6 (position 23610693)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19866139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTTAATAAAAAAAAAACTGTTTCTTCCTAGGACCAGGAGCTGGCATA[T/G]GAGTGTGTATTGGTGATCGAGGGCCAAACTGTGGTGGTTGATGCAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1222 2220 15 36
Genomic Location (Zv9):
Chromosome 6 (position 23604635)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19860081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTACAACTACAGCAAGTGGCAAGGAGAAGTCTGGTCACATCTCGGTG[A/T]GAGTTTCTGGTGGAGGTTTCGGCTTGTCAAGTCAGATATTCAGCTACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1381 2220 18 36
ENSDART00000042248 Nonsense 1381 2220 18 36
Genomic Location (Zv9):
Chromosome 6 (position 23594519)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19849965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGACGGTGTTCCCAACAGACTCCATTTCCACCTGGAAAAAACAAAGA[C/T]GAAGGAGAAAAACTAGAAGTACAACAGATGTGGAAGTGCTGGAAACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Essential Splice Site 1893 2220 28 36
Genomic Location (Zv9):
Chromosome 6 (position 23576133)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19831579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MTGTATCCTGCTTTTTTCTTTTTTTNCATTGTTTCTTTTCAYATTTTTCA[G/T]AATGGCGCTCTGGCGTAGCTGGTCATCTAATCCTGTCAGATGAAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1936 2220 29 36
Genomic Location (Zv9):
Chromosome 6 (position 23572897)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19828343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTACTTTTCACTGGATTTTAGGTTCCAGATGGAGCAACTGTTGCTT[T/A]GGTGCCACGCCATAGCAAACACATTCACCATGATACCCACGATTACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 1987 2220 30 36
Genomic Location (Zv9):
Chromosome 6 (position 23569698)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19825144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGCATCTGGTGAAGGCCAGCGAGGAGCCAGAGTTACCCAAACACAGA[C/T]GAGGCAGTTTAAAAGAACGAGAACGAGCCAAGACCATTCCAGAGATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042248 Nonsense 2003 2220 30 36
Genomic Location (Zv9):
Chromosome 6 (position 23569648)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19825094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGCAGTTTAAAAGAACGAGAACGAGCCAAGACCATTCCAGAGATTTA[T/A]CTCACGCGGCTCCTGTCAATGAAGGTGTCCTGACAAATACACAATCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link