si:dkey-190l1.1

Ensembl ID:
ENSDARG00000017199
ZFIN ID:
ZDB-GENE-060503-525
Description:
Elongator complex protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q05AM5]
Human Orthologue:
ELP2
Human Description:
elongation protein 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:18248]
Mouse Orthologue:
Elp2
Mouse Description:
elongation protein 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1889642]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11574 Nonsense Available for shipment Available now
sa11138 Nonsense Available for shipment Available now
sa23564 Nonsense Available for shipment Available now
sa36873 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039749 Nonsense 57 821 2 22
ENSDART00000122625 Nonsense 57 836 2 22
Genomic Location (Zv9):
Chromosome 19 (position 36290338)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35154858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATTGTCATCAGGAAATAAGAGTTGTCGATCTGCTGAATAAACATACT[G/T]GAAGGGTGAACGCCGTCCAGTGGGTCCATGAACCAGACTGCAGTAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039749 Nonsense 173 821 6 22
ENSDART00000122625 Nonsense 173 836 6 22
Genomic Location (Zv9):
Chromosome 19 (position 36286484)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35151004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGAGTGAGGAGRAWATTTCCGTCTCTTGCAGTTCCCGKATTGGCCTG[T/A]GGGGGRGATGATAGCAGAGTTCATCTGTATGTGCAGCTCAGTGGACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039749 Nonsense 567 821 17 22
ENSDART00000122625 Nonsense 582 836 17 22
Genomic Location (Zv9):
Chromosome 19 (position 36257186)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35121706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCAGGTACGGGCATGGCTTTGAGATGTTTTGTCTGGCGTCGGATTG[T/A]GCGAGGACGGTGGTGGCCTCGGCGTGTAAGGTACAATCACACGGGTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039749 Essential Splice Site 729 821 20 22
ENSDART00000122625 Essential Splice Site 744 836 20 22
Genomic Location (Zv9):
Chromosome 19 (position 36245384)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35109904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCAGCTACTGCCGTGTCTATCTGCCCATTTCTATGTTCAGATCACAG[G/A]TAACGTTACGCAGGATGTGAGGCCATCATTAAAATCAGTGTCATCTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link