foxq1l

Ensembl ID:
ENSDARG00000017195
ZFIN ID:
ZDB-GENE-070424-74
Description:
forkhead box protein F2 [Source:RefSeq peptide;Acc:NP_001077284]
Human Orthologue:
FOXF2
Human Description:
forkhead box F2 [Source:HGNC Symbol;Acc:3810]
Mouse Orthologue:
Foxf2
Mouse Description:
forkhead box F2 Gene [Source:MGI Symbol;Acc:MGI:1347479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32818 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028159 Nonsense 33 383 1 2
Genomic Location (Zv9):
Chromosome 2 (position 897341)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 843633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTCCAGCCCGGCATCCAACAGCATGCACTCGGCTCTCCAAAACACG[C/T]AGACAGTGCTGGAAAGCACCACTGCCACCGGCAATAAAGGCAAGAAGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link