cnn1a

Ensembl ID:
ENSDARG00000017193
ZFIN ID:
ZDB-GENE-090312-141
Description:
hypothetical protein LOC567396 [Source:RefSeq peptide;Acc:NP_001139070]
Human Orthologue:
CNN1
Human Description:
calponin 1, basic, smooth muscle [Source:HGNC Symbol;Acc:2155]
Mouse Orthologue:
Cnn1
Mouse Description:
calponin 1 Gene [Source:MGI Symbol;Acc:MGI:104979]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32772 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1965 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa32772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010236 Essential Splice Site 21 287 2 7
Genomic Location (Zv9):
Chromosome 1 (position 52716031)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51586980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATCATTATTCTTAATCATTATTTTATTATATTGCCCTTGATATGACA[G/A]CTGGCACAGAAATATGACCCTCAGACGGAGGAGGACCTGAGGATGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1965
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010236 Nonsense 43 287 2 7
Genomic Location (Zv9):
Chromosome 1 (position 52715964)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51586913
KASP Assay ID:
554-2451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTCAGACGGAGGAGGACCTGAGGATGTGGGTCCAGGAGATCACAGGA[C/T]GAACACTTGCAGAAAACTTCATGGAGGGGCTGAARGACGGYGTGATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link