si:ch211-223m11.2

Ensembl ID:
ENSDARG00000017188
ZFIN ID:
ZDB-GENE-040724-123
Description:
hypothetical protein LOC558615 [Source:RefSeq peptide;Acc:NP_001038334]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23652 Essential Splice Site Available for shipment Available now
sa10977 Nonsense Available for shipment Available now
sa43399 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104032 Essential Splice Site 7 890 1 21
Genomic Location (Zv9):
Chromosome 20 (position 14028831)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14218077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATATACACTTTAAAAGAATCCAAGAATGAGGTGCTTTGAAACAGGG[T/A]ATGTGTGGGGATGTTTAAATATTAAGGTTTGGACCACGAGGTGTTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104032 Nonsense 327 890 10 21
Genomic Location (Zv9):
Chromosome 20 (position 14020635)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14209881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTGACTAACCTGWTTTAATTACAGAGCCATACTCTTAAGGATCAGTA[T/A]CATMTCAGTTACACCATAGAGCCCATGCTTGAGTTACTGTGGCRGGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104032 Essential Splice Site 440 890 12 21
Genomic Location (Zv9):
Chromosome 20 (position 14020151)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14209397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCTTTTTTAATTTGGCATGGGTTAATATACTGTAGTTGTTTCAATGC[A/T]GAAAGTTCACCTTGATAAAACAACCTACACTCTTCCTGTTGTCTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104032 Nonsense 639 890 15 21
Genomic Location (Zv9):
Chromosome 20 (position 14018671)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14207917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARACCACTTTGCTTATTTTCGCTATAATGTCAMCAGTTGTGGAACCACW[C/T]GAAAGGTACATTTGTGGTACAAGGGGACTTGTCAAGTACTTGTAAAGCWG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link