nr2f1b

Ensembl ID:
ENSDARG00000017168
ZFIN IDs:
ZDB-GENE-000112-32, ZDB-GENE-040426-1438
Description:
Nuclear receptor subfamily 2 group F member 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PH18]
Human Orthologue:
NR2F2
Human Description:
nuclear receptor subfamily 2, group F, member 2 [Source:HGNC Symbol;Acc:7976]
Mouse Orthologue:
Nr2f2
Mouse Description:
nuclear receptor subfamily 2, group F, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352452]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34990 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027242 Nonsense 79 389 1 3
Genomic Location (Zv9):
Chromosome 10 (position 45299809)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43950872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGGAAGCACTACGGACAGTTCACCTGCGAGGGATGCAAAAGTTTCTTC[A/T]AGCGAAGTGTCCGGCGGAATTTATCGTACACGTGCCGCGCCAACAGAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link