pla2g4a

Ensembl ID:
ENSDARG00000017141
ZFIN ID:
ZDB-GENE-041014-325
Description:
Novel protein similar to cytosolic phospholipase a2 (Cpla2) [Source:UniProtKB/TrEMBL;Acc:Q5RIP7]
Human Orthologue:
PLA2G4A
Human Description:
phospholipase A2, group IVA (cytosolic, calcium-dependent) [Source:HGNC Symbol;Acc:9035]
Mouse Orthologue:
Pla2g4a
Mouse Description:
phospholipase A2, group IVA (cytosolic, calcium-dependent) Gene [Source:MGI Symbol;Acc:MGI:1195256]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43487 Nonsense Mutation detected in F1 DNA During 2017
sa37091 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023211 Nonsense 105 729 4 18
ENSDART00000135915 Nonsense 80 697 3 16
Genomic Location (Zv9):
Chromosome 20 (position 34157329)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34229842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGGATGCTAACTATGTTGTGGATGAAACGTTGGGTACAGCCTCATA[T/G]GACATCTCTAAACTCAAAGTTGGACAAACAATGCTGGTGTCATTCCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023211   729 729 18 18
ENSDART00000135915 Nonsense 692 697 16 16
Genomic Location (Zv9):
Chromosome 20 (position 34168959)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34241472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTCCATCTCGCTGCTCTGCATCTCTTTCTCTCAGTGAAGCACAAAAG[A/T]AAAAACGCCTAAAGAAATAGTCTAAAGGACAAGCCTGTTAATAAGGAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)
  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link