myof

Ensembl ID:
ENSDARG00000017128
Human Orthologue:
MYOF
Human Description:
myoferlin [Source:HGNC Symbol;Acc:3656]
Mouse Orthologue:
Myof
Mouse Description:
myoferlin Gene [Source:MGI Symbol;Acc:MGI:1919192]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35511 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22321 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22322 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31933 Nonsense Mutation detected in F1 DNA During 2016
sa28125 Nonsense Mutation detected in F1 DNA During 2016
sa28126 Nonsense Mutation detected in F1 DNA During 2016
sa10226 Nonsense Available for shipment Available now
sa31934 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 270 2045 8 53
Genomic Location (Zv9):
Chromosome 13 (position 29472124)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29118072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAACATGCTGCCTTCTGAGCTTTTTGATGAGAGCATCATGATCCGGG[T/C]AAGATGAGGCAATCCACAAGTTGACAATATTTCTTAATTAGCAATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 533 2045 18 53
Genomic Location (Zv9):
Chromosome 13 (position 29480793)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29126741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATTTACTGGCCTACCTGACCCATATGAGGATCTGAATTACGGCAAG[G/A]TGAGTGTAGTAAAGAAAAATGTTGTGCTATGGGACTGACTGCTGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 630 2045 20 53
Genomic Location (Zv9):
Chromosome 13 (position 29482502)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29128450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAACCACTGGCCTCTACTACTCAGTACAGCTGTGCTGTTTTTGATG[G/A]TGAGTTTCTCATAATGCCAGAGTGATAGCACATAAAAACACACTTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 667 2045 21 53
Genomic Location (Zv9):
Chromosome 13 (position 29482703)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29128651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGAGGACATAAGTCATCGTTTGGATTCAGTGAACATCATTCTGTA[T/G]ATTTCTGATCGACTGGTAGGATTTTAATCTTTATGCCATTCGGCAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1250 2045 34 53
Genomic Location (Zv9):
Chromosome 13 (position 29492961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29138909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACCCATTAATACCTAAACTCTTTTGGTTTCCCATCTCCTTGAAGGGA[C/T]GAAGTGCAGGGGAGATGCTGGTAGCAGCTGAGCTCTTGCTCAAAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1312 2045 36 53
Genomic Location (Zv9):
Chromosome 13 (position 29495173)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29141121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGCTTCGACAGATCCTGGCCTGGGGATTAAGAAACATGAAGGCATA[T/A]CAGCTGGCAGCGGTGTCTTCCCCCAGCCTGGTAGTTGAATGTGGAGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1555 2045 41 53
Genomic Location (Zv9):
Chromosome 13 (position 29504960)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29150908
KASP Assay ID:
2260-6518.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTCAGGAGTGCCTGGTCAGAATCCAYAKCATAYGTTGCCTCGACCTG[C/T]AGCCTAAAGACAACAATRGCATGGTGAGTTTCCAGTGRTGTAAAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 2035 2045 53 53
Genomic Location (Zv9):
Chromosome 13 (position 29512467)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29158415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTATATTATGTGTGTTTTTAAATATTTGCCCTTTCATCTCTTTTC[A/T]GAACTACCTTTCCATGAAACTCGTAAAGCCATTTTAATAGGAAAAATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link