myof

Ensembl ID:
ENSDARG00000017128
Human Orthologue:
MYOF
Human Description:
myoferlin [Source:HGNC Symbol;Acc:3656]
Mouse Orthologue:
Myof
Mouse Description:
myoferlin Gene [Source:MGI Symbol;Acc:MGI:1919192]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22321 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22322 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10226 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 533 2045 18 53
Genomic Location:
Chromosome 13 (position 29480793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATTTACTGGCCTACCTGACCCATATGAGGATCTGAATTACGGCAAG[G/A]TGAGTGTAGTAAAGAAAAATGTTGTGCTATGGGACTGACTGCTGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 630 2045 20 53
Genomic Location:
Chromosome 13 (position 29482502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAACCACTGGCCTCTACTACTCAGTACAGCTGTGCTGTTTTTGATG[G/A]TGAGTTTCTCATAATGCCAGAGTGATAGCACATAAAAACACACTTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1555 2045 41 53
Genomic Location:
Chromosome 13 (position 29504960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTCAGGAGTGCCTGGTCAGAATCCAYAKCATAYGTTGCCTCGACCTG[C/T]AGCCTAAAGACAACAATRGCATGGTGAGTTTCCAGTGRTGTAAAGGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/11bw240m