ilvbl

Ensembl ID:
ENSDARG00000017126
ZFIN ID:
ZDB-GENE-040426-1623
Description:
Acetolactate synthase-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6NV04]
Human Orthologue:
ILVBL
Human Description:
ilvB (bacterial acetolactate synthase)-like [Source:HGNC Symbol;Acc:6041]
Mouse Orthologue:
Ilvbl
Mouse Description:
ilvB (bacterial acetolactate synthase)-like Gene [Source:MGI Symbol;Acc:MGI:1351911]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10157 Nonsense Available for shipment Available now
sa19208 Nonsense Mutation detected in F1 DNA During 2016
sa36724 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location (Zv9):
Chromosome 18 (position 43185980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44775871
KASP Assay ID:
2261-2579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTMTTTCATAAGGTAATGAGGATTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location (Zv9):
Chromosome 18 (position 43185980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44775871
KASP Assay ID:
2261-2579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTCTTTCATAAGGTAATGAGGATTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 165 621 5 16
ENSDART00000145190 Nonsense 165 242 4 6
Genomic Location (Zv9):
Chromosome 18 (position 43192905)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44782796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGATATCGACCAGATGTCTCTCTTCAAGCCTCTCTGTAAGTTCTG[T/A]GCATCAGTGAGGACTGTGAGAGAAATAGTTCCCACTGTTAGAAAAGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link