ilvbl

Ensembl ID:
ENSDARG00000017126
ZFIN ID:
ZDB-GENE-040426-1623
Description:
Acetolactate synthase-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6NV04]
Human Orthologue:
ILVBL
Human Description:
ilvB (bacterial acetolactate synthase)-like [Source:HGNC Symbol;Acc:6041]
Mouse Orthologue:
Ilvbl
Mouse Description:
ilvB (bacterial acetolactate synthase)-like Gene [Source:MGI Symbol;Acc:MGI:1351911]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10157 Nonsense Available for shipment Available now
sa19208 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location:
Chromosome 18 (position 43185980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTMTTTCATAAGGTAATGAGGATTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location:
Chromosome 18 (position 43185980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTCTTTCATAAGGTAATGAGGATTGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qfajuims