nr2e1

Ensembl ID:
ENSDARG00000017107
ZFIN ID:
ZDB-GENE-040801-127
Description:
nuclear receptor subfamily 2 group E member 1 [Source:RefSeq peptide;Acc:NP_001003608]
Human Orthologue:
NR2E1
Human Description:
nuclear receptor subfamily 2, group E, member 1 [Source:HGNC Symbol;Acc:7973]
Mouse Orthologue:
Nr2e1
Mouse Description:
nuclear receptor subfamily 2, group E, member 1 Gene [Source:MGI Symbol;Acc:MGI:1100526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37076 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026635 Essential Splice Site 257 396 6 9
Genomic Location (Zv9):
Chromosome 20 (position 32479556)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32537796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAGTGGGCCATTCCAGTAGACTCCAGTACCCTCCTAGCTGTTTCAG[G/A]TAGGCCATATTTACACTGTATTAATGCCTGCGAAGTGCATGGATGTTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link