chordc1

Ensembl ID:
ENSDARG00000017067
ZFIN ID:
ZDB-GENE-040426-1288
Description:
Cysteine and histidine-rich domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3F7]
Human Orthologue:
CHORDC1
Human Description:
cysteine and histidine-rich domain (CHORD)-containing 1 [Source:HGNC Symbol;Acc:14525]
Mouse Orthologue:
Chordc1
Mouse Description:
cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45407 Nonsense Mutation detected in F1 DNA During 2018
sa45103 Nonsense Mutation detected in F1 DNA During 2018
sa15475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024514 Nonsense 175 341 7 11
ENSDART00000024514 Nonsense 175 341 7 11
Genomic Location (Zv9):
Chromosome 10 (position 25835288)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25239246
GRCz11 10 25209922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTTTTCAGACATTCGCTGGACAAGCCAGTGATGATGAGACCTGTT[T/A]GTATCACGCTGGCGTGCCTATTTTCCATGAAGGGTAAATTAGCTACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024514 Nonsense 175 341 7 11
ENSDART00000024514 Nonsense 175 341 7 11
Genomic Location (Zv9):
Chromosome 10 (position 25835288)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25239246
GRCz11 10 25209922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTTTTCAGACATTCGCTGGACAAGCCAGTGATGATGAGACCTGTT[T/A]GTATCACGCTGGCGTGCCTATTTTCCATGAAGGGTAAATTAGCTACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024514 Nonsense 234 341 9 11
Genomic Location (Zv9):
Chromosome 10 (position 25837802)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25241760
GRCz11 10 25212180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTATGTGTGCAGGGAAAGAAAGTTGTACCTTGCAGGTTTGATTGGCAC[C/T]AAACAGGAAGTCAGGTCATCATTTCCATTTATGCSAAAAACTCAGTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link