chordc1

Ensembl ID:
ENSDARG00000017067
ZFIN ID:
ZDB-GENE-040426-1288
Description:
Cysteine and histidine-rich domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3F7]
Human Orthologue:
CHORDC1
Human Description:
cysteine and histidine-rich domain (CHORD)-containing 1 [Source:HGNC Symbol;Acc:14525]
Mouse Orthologue:
Chordc1
Mouse Description:
cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024514 Nonsense 234 341 9 11
Genomic Location:
Chromosome 10 (position 25837802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTATGTGTGCAGGGAAAGAAAGTTGTACCTTGCAGGTTTGATTGGCAC[C/T]AAACAGGAAGTCAGGTCATCATTTCCATTTATGCSAAAAACTCAGTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n498ezs7