gyltl1b

Ensembl ID:
ENSDARG00000017058
ZFIN ID:
ZDB-GENE-050419-253
Description:
Glycosyltransferase-like protein LARGE2 [Source:UniProtKB/Swiss-Prot;Acc:Q66PG1]
Human Orthologue:
GYLTL1B
Human Description:
glycosyltransferase-like 1B [Source:HGNC Symbol;Acc:16522]
Mouse Orthologue:
Gyltl1b
Mouse Description:
glycosyltransferase-like 1B Gene [Source:MGI Symbol;Acc:MGI:2443769]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15151 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015786 Essential Splice Site 371 750 9 15
ENSDART00000127953 Essential Splice Site 371 750 8 14
Genomic Location:
Chromosome 18 (position 43658548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCACACTCGCTCTGAACAGTGTTACACTGAAGTGTCCGATCTAAAGG[T/C]AACAGCATATATAGGAGAATATTTCAACSCAGACTCATTCATTTCTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9r7903my