ikbkg

Ensembl ID:
ENSDARG00000017037
ZFIN ID:
ZDB-GENE-050327-68
Description:
NF-kappa-B essential modulator [Source:RefSeq peptide;Acc:NP_001014366]
Human Orthologue:
IKBKG
Human Description:
inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Ikbkg
Mouse Description:
inhibitor of kappaB kinase gamma Gene [Source:MGI Symbol;Acc:MGI:1338074]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24293 Nonsense Available for shipment Available now
sa29899 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008847 Nonsense 316 586 7 13
ENSDART00000079852 Nonsense 332 602 8 14
ENSDART00000122280 Nonsense 332 602 8 14

The following transcripts of ENSDARG00000017037 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 18754908)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18657847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCGCTGAGATCGCAAGTAACGTCGCTTCTCGGAGAGCTGAACGAA[C/T]GACAAAACTGGCTGGAGAAGAGCGAAGCAGAGAAACGAACCTTAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008847 Nonsense 417 586 10 13
ENSDART00000079852 Nonsense 433 602 11 14
ENSDART00000122280 Nonsense 433 602 11 14

The following transcripts of ENSDARG00000017037 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 18751779)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18654718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAGTTGTTCATGGAAACTATGTGTGGTATTTACCTTTTAAGGGTGGA[G/T]AGACGGATACCCTTGCTAACAGGTTAGGGGAGGCTGAGAAAGCACTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link