ENSDARG00000017036

Ensembl ID:
ENSDARG00000017036
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20089 Nonsense Mutation detected in F1 DNA During 2014
sa9049 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5218 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Nonsense 22 1533 1 29
Genomic Location:
Chromosome 3 (position 39147197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGGAGTCCAGAGCTGAACGGATCGCTCGCTACAAAGCAGAGAGGCGG[A/T]GAGAGCTGGCAGAACGTTACGGCAGCCAAGAAGAGGAGCTTCCATCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Essential Splice Site 1207 1533 23 29
Genomic Location:
Chromosome 3 (position 39113150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACAGACAGCTCCACTTATTGCATGTGACAGTGTGTTTGGTGTGTTTC[A/G]GAAGCCTGGCGTCTGTTCTGTGTGAGGGGTGATGTGCCGATAGAGGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Nonsense 1371 1533 25 29
Genomic Location:
Chromosome 3 (position 39111222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCATCACAGCAATGCCCTTCCTTCAAGATAAGCTATACACTGTGCCA[C/T]AACCAGGTAAGACCATCCACGCACAGAAACAAAGTACACATGAAGGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xtslc71z