ywhae2

Ensembl ID:
ENSDARG00000017014
ZFIN ID:
ZDB-GENE-050306-44
Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide 2 [Sour
Human Orthologues:
AC113211.1, YWHAE
Human Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide pseudoge
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide [Source:
Mouse Orthologue:
Ywhae
Mouse Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Gene [So

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011303 Nonsense 131 255 4 6
Genomic Location:
Chromosome 7 (position 75477848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTTTTGAATGCGTGTGTTTTYAGGAAAGGGGACTATCACAGGTA[T/A]CTGGCAGAGTTCGCCACRGGTAACGACCGTAAGGAARCGGCRGAGAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rfg0gbpn