dennd5a

Ensembl ID:
ENSDARG00000017006
ZFIN ID:
ZDB-GENE-071211-1
Human Orthologue:
DENND5A
Human Description:
DENN/MADD domain containing 5A [Source:HGNC Symbol;Acc:19344]
Mouse Orthologue:
Dennd5a
Mouse Description:
DENN/MADD domain containing 5A Gene [Source:MGI Symbol;Acc:MGI:1201681]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41068 Nonsense Mutation detected in F1 DNA During 2017
sa15229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060545 Nonsense 546 1288 7 23
Genomic Location (Zv9):
Chromosome 7 (position 66886420)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64801494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGATTATGAGGTGTTTGTTATTCAGCCCAGCCAAGACAAAGAGTCCTG[G/A]TTCAGCAACCGAGACCAGATGCAGAACTTTGACAAGGTGAGGATTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060545 Nonsense 825 1288 13 23
Genomic Location (Zv9):
Chromosome 7 (position 66870496)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64785570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGTTTGCCAGGGAAAATCCGCCCTGTGGTCGCACCTTTTACATTA[T/A]CAAGAGAGTAAAGAGAAGAGAGACGCTACTCCAGCAGGCCTCGGCCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link