myo10l2

Ensembl ID:
ENSDARG00000017004
ZFIN ID:
ZDB-GENE-070912-277
Description:
Novel protein similar to vertebrate myosin X (MYO10) [Source:UniProtKB/TrEMBL;Acc:B0S541]
Human Orthologue:
MYO10
Human Description:
myosin X [Source:HGNC Symbol;Acc:7593]
Mouse Orthologue:
Myo10
Mouse Description:
myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11921 Nonsense Available for shipment Available now
sa19845 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19844 Nonsense Mutation detected in F1 DNA During 2014
sa19843 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043201 Nonsense 344 1753 11 32
ENSDART00000124493 None None 243 None 6
ENSDART00000139515 None None 107 None 3
ENSDART00000140159 Nonsense 660 2069 20 41

The following transcripts of ENSDARG00000017004 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42731710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGCCCGGTCAGTTTGAGCAGACTGTGGTCCTCAATCAGCTCAGATA[T/G]TCTGGGATGTTGGAAACRGTGAAAATCAGACGTTCTGGGTTTCCCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043201 Essential Splice Site 409 1753 13 32
ENSDART00000124493 None None 243 None 6
ENSDART00000139515 None None 107 None 3
ENSDART00000140159 Essential Splice Site 725 2069 22 41

The following transcripts of ENSDARG00000017004 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42730046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATCAGGCTTGAATGATGGGCTGCATTTGTTGTCTTTTCATTTTGC[A/T]GGTGTTTATGAGAGAGAGTTTGGAGCTGCGGTTAGAAAAACAAAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043201 Nonsense 490 1753 14 32
ENSDART00000124493 None None 243 None 6
ENSDART00000139515 None None 107 None 3
ENSDART00000140159 Nonsense 806 2069 23 41

The following transcripts of ENSDARG00000017004 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42729709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGATGGGCCACCGTCACCTTACAGAAGAGGCTCAGAGGTCAAAGGGCA[C/T]GAAGGCTCTATGTTCACCTTTTAGAGGAGAAGAGGAAGAGGGAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043201 Essential Splice Site 1465 1753 None 32
ENSDART00000124493 None None 243 None 6
ENSDART00000139515 None None 107 None 3
ENSDART00000140159 Essential Splice Site 1781 2069 None 41

The following transcripts of ENSDARG00000017004 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42713378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGAGAGCAGGACTGTGGTGGCCGACATCCTCGCCAAGTTTGAGAAG[T/C]GAGTCTCACCTTTTACACACCAGCTTCAGTCTGTCCAAAACCACAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k45a8svx