bcar3

Ensembl ID:
ENSDARG00000016981
ZFIN ID:
ZDB-GENE-080513-4
Description:
breast cancer anti-estrogen resistance protein 3 [Source:RefSeq peptide;Acc:NP_001107092]
Human Orthologue:
BCAR3
Human Description:
breast cancer anti-estrogen resistance 3 [Source:HGNC Symbol;Acc:973]
Mouse Orthologue:
Bcar3
Mouse Description:
breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17906 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110550 Essential Splice Site 691 912 9 13
ENSDART00000138253 None None 209 None 3
ENSDART00000138855 Essential Splice Site 620 841 8 12
ENSDART00000141763 None None 137 None 3
ENSDART00000142358 Essential Splice Site 525 746 6 10
Genomic Location:
Chromosome 8 (position 15608602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGACCCTTCCTCATGGACGACAGCTGAGGCTGGACCTCATAGAGAG[G/A]TAAACAGATKYAGTCAACACGTCATGATRGCTCACTACAGACATCTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zxtdc5ll