bcar3

Ensembl ID:
ENSDARG00000016981
ZFIN ID:
ZDB-GENE-080513-4
Description:
breast cancer anti-estrogen resistance protein 3 [Source:RefSeq peptide;Acc:NP_001107092]
Human Orthologue:
BCAR3
Human Description:
breast cancer anti-estrogen resistance 3 [Source:HGNC Symbol;Acc:973]
Mouse Orthologue:
Bcar3
Mouse Description:
breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44681 Nonsense Mutation detected in F1 DNA During 2017
sa17906 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110550 Nonsense 65 912 2 13
ENSDART00000138253   None 208 None 3
ENSDART00000138855   None 841 None 12
ENSDART00000141763 Nonsense 28 137 2 3
ENSDART00000142358   None 746 None 10
Genomic Location (Zv9):
Chromosome 8 (position 15719472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCATCGAATCCATATTCTCTCTAGTATCCAAGTCCTGCGAGAACGT[G/T]AAACAAAACGAGGTTAGTCTTGCTTTTTCTGAATCTACTGTCAGACTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110550 Essential Splice Site 691 912 9 13
ENSDART00000138253   None 209 None 3
ENSDART00000138855 Essential Splice Site 620 841 8 12
ENSDART00000141763   None 137 None 3
ENSDART00000142358 Essential Splice Site 525 746 6 10
Genomic Location (Zv9):
Chromosome 8 (position 15608602)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15053946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGACCCTTCCTCATGGACGACAGCTGAGGCTGGACCTCATAGAGAG[G/A]TAAACAGATKYAGTCAACACGTCATGATRGCTCACTACAGACATCTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link