Q7SYK4_DANRE

Ensembl ID:
ENSDARG00000016968
Description:
LOC402840 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYK4]
Human Orthologue:
TMEM214
Human Description:
transmembrane protein 214 [Source:HGNC Symbol;Acc:25983]
Mouse Orthologue:
Tmem214
Mouse Description:
transmembrane protein 214 Gene [Source:MGI Symbol;Acc:MGI:1916046]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16542 Nonsense Available for shipment Available now
sa30843 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40194 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Nonsense 367 675 9 16
Genomic Location (Zv9):
Chromosome 4 (position 478972)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 758828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGCACACATATTTCCCATCATTCCTGTCACGAGCCACACCCAACTG[T/A]CCTGGTGYCATGAAGAAAGAGGTGAGAYGCACRTATTCTGTTTGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Essential Splice Site 585 675 14 16
ENSDART00000128743 Essential Splice Site 585 675 14 16
Genomic Location (Zv9):
Chromosome 4 (position 473206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 753062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Essential Splice Site 585 675 14 16
ENSDART00000128743 Essential Splice Site 585 675 14 16
Genomic Location (Zv9):
Chromosome 4 (position 473206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 753062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link