neurog3

Ensembl ID:
ENSDARG00000016951
ZFIN ID:
ZDB-GENE-010608-4
Description:
neurogenin 3 [Source:RefSeq peptide;Acc:NP_571890]
Human Orthologues:
NEUROG1, NEUROG2, NEUROG3
Human Descriptions:
neurogenin 1 [Source:HGNC Symbol;Acc:7764]
neurogenin 2 [Source:HGNC Symbol;Acc:13805]
neurogenin 3 [Source:HGNC Symbol;Acc:13806]
Mouse Orthologues:
Neurog1, Neurog2, Neurog3
Mouse Descriptions:
neurogenin 1 Gene [Source:MGI Symbol;Acc:MGI:107754]
neurogenin 2 Gene [Source:MGI Symbol;Acc:MGI:109619]
neurogenin 3 Gene [Source:MGI Symbol;Acc:MGI:893591]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa211 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa211
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002863 Nonsense 74 208 2 2
Genomic Location (Zv9):
Chromosome 13 (position 25985534)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25631194
KASP Assay ID:
554-0155.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGACAAAACAAGCAATAGAAAACTGAAGAAACTCATGTCAACAAGC[A/T]GACAGCGTGGAAATCGCAGAGTTAAGGCAAACGACAGAGAAAGGCACCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link