sb:cb54

Ensembl ID:
ENSDARG00000016945
ZFIN ID:
ZDB-GENE-030131-9886
Description:
Sb:cb54 protein [Source:UniProtKB/TrEMBL;Acc:A4IG06]
Human Orthologues:
SIPA1, SIPA1L1, SIPA1L2, SIPA1L3
Human Descriptions:
signal-induced proliferation-associated 1 like 1 [Source:HGNC Symbol;Acc:20284]
signal-induced proliferation-associated 1 like 2 [Source:HGNC Symbol;Acc:23800]
signal-induced proliferation-associated 1 like 3 [Source:HGNC Symbol;Acc:23801]
signal-induced proliferation-associated 1 [Source:HGNC Symbol;Acc:10885]
Mouse Orthologues:
Sipa1, Sipa1l1, Sipa1l2, Sipa1l3
Mouse Descriptions:
signal-induced proliferation associated gene 1 Gene [Source:MGI Symbol;Acc:MGI:107576]
signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]
signal-induced proliferation-associated 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2676970]
signal-induced proliferation-associated 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1921456]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42303 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003390 Essential Splice Site 123 281 3 6
Genomic Location (Zv9):
Chromosome 13 (position 49855474)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48627711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGATGTGTGCAGCCGCTCATCCTTCTGTCTCTCTCTCTCTGTCTCTTC[A/T]GATGAGTTCTGGTTCTCTGACGGCTCTCTCGCCGACCGGGCCAAGTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link