LOC557797

Ensembl ID:
ENSDARG00000016939
Human Orthologue:
ITGB2
Human Description:
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) [Source:HGNC Symbol;Acc:6155]
Mouse Orthologues:
Itgb2, Itgb2l
Mouse Descriptions:
integrin beta 2 Gene [Source:MGI Symbol;Acc:MGI:96611]
integrin beta 2-like Gene [Source:MGI Symbol;Acc:MGI:1277979]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11250 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048901 Nonsense 588 768 12 15
Genomic Location:
Chromosome 9 (position 46033085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGCGCTAAATCCGACAATGAATGCAAGATTGACRRCCATGTTTGTTA[T/G]AACCGCGGTAAATGTGTATGTAACCAGTGCGAATGTGARAGGGGATACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0684h4t5