hmcn1

Ensembl ID:
ENSDARG00000016936
ZFIN ID:
ZDB-GENE-041014-322
Description:
hemicentin 1 [Source:RefSeq peptide;Acc:NP_001177233]
Human Orthologue:
HMCN1
Human Description:
hemicentin 1 [Source:HGNC Symbol;Acc:19194]
Mouse Orthologue:
Hmcn1
Mouse Description:
hemicentin 1 Gene [Source:MGI Symbol;Acc:MGI:2685047]

Alleles

There are 18 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9806 Essential Splice Site Available for shipment Available now
sa37095 Nonsense Mutation detected in F1 DNA During 2016
sa37094 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23757 Nonsense Mutation detected in F1 DNA During 2016
sa32307 Nonsense Mutation detected in F1 DNA During 2016
sa39291 Nonsense Mutation detected in F1 DNA During 2016
sa37093 Nonsense Mutation detected in F1 DNA During 2016
sa16438 Nonsense Available for shipment Available now
sa17994 Nonsense Available for shipment Available now
sa43489 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4918 Nonsense Mutation detected in F1 DNA During 2016
sa37092 Nonsense Mutation detected in F1 DNA During 2016
sa19239 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11019 Essential Splice Site Available for shipment Available now
sa23756 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32306 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30717 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43488 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 1164 5616 24 107
ENSDART00000144705 Essential Splice Site 1081 5534 23 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34244512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTCRGCTTTCKCAMTTTTATTAATACTCCTTTCTCTTTWTTTTGCA[G/A]TTCSTCCCAGCATCMGTGCAGGTCCCCGAGCCATRAAAGTGCAGATCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 1232 5616 24 107
ENSDART00000144705 Nonsense 1149 5534 23 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34244306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAGCTCTGACTCTAAACCAGGTGGCGCTTACAGATGAAGGCATCTA[T/A]GTCTGCAGGGCCGTCAACATTGCTGGAAAAGAAGAAACTGCTATTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 1252 5616 24 107
ENSDART00000144705 Essential Splice Site 1169 5534 23 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34244244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCAACATTGCTGGAAAAGAAGAAACTGCTATTCAACTACATGTGCAGG[G/A]TTAGATGTTAAATGTTGACATCTACAACTGTGCTTTTTAGCTTTAAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 1608 5616 31 107
ENSDART00000144705 Nonsense 1525 5534 30 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34237266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGGGCAGTTCCTCAAGATCTTAAGAGCTCAAGTTTCTGATGCTGGA[C/T]AGTACACATGTAGAGTCACCAGTGTGGCTGGCACTGCTGAAAAAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 1901 5616 36 107
ENSDART00000144705 Nonsense 1818 5534 35 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34232555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGCTGGGAAATATACATGTGTGGCAACTAATGCAGCAGGCGAGGCA[C/T]AACAGCATATTCGCCTAAGTGTGCACGGTATGAGGTTTATGACAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2012 5616 39 107
ENSDART00000144705 Nonsense 1929 5534 38 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34230257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGATGTATTCTGTTGTTTTAGTTCCTCCCACTATCTCCAGTAAAGGA[G/T]GAATGGTAACAGTGGTGGTGAATGATCCAGTCAGGTTAGAGTGTGAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2482 5616 48 107
ENSDART00000144705 Nonsense 2401 5534 47 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34220031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCACCCAGCATTGTGAACGAGGGCACAGTAGAGGATGTGAAAGTGAAA[G/T]AGAGACAGAATGCCATTTTGGCCTGTGAGGTCACTGGTAAGTGACACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2698 5616 52 107
ENSDART00000144705 Nonsense 2617 5534 51 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34218338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGCYGGAGTGTGAAGCTCAAGCTATCCCAAYACCGACACTAGTGTGGTA[C/A]AAGGATGGTCAGGTGAGAAWTGCACAAAACTCWRAATATTTTNCTCCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2846 5616 55 107
ENSDART00000144705 Nonsense 2765 5534 54 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34216299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACACATGTGTRGCTGTGAATGAGGCTGGTGAAGACTCAATCCAGTA[T/A]GATGTCAGAGTGTTGTGTGAGTATATTGTTTTGTACATGCTAAACATSAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 2947 5616 57 107
ENSDART00000144705 Essential Splice Site 2866 5534 56 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34215362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAACTTAGCTGGGACAGCAGAGAAATCCTTCAACTTGCATGTGCATGG[T/G]GAGTATATTTAGATTTTTCCCTTGCATTGCATTTTAAGTTATCCATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 3181 5616 63 107
ENSDART00000144705 Nonsense 3100 5534 62 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34211191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCAAAATATGTCTAATGCTTGTTTTGATTGTCTTTGTAGAAAAYTCA[G/T]AGTCTCTAGAGATGCATATCCTGTCTGGGGGCAGTAAGCTGCAGATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 3207 5616 63 107
ENSDART00000144705 Nonsense 3126 5534 62 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34211111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGTAAGCTGCAGATTTCCCGCTCACAGTTATCTGACAGTGGCACTTA[C/A]ACCTGTGTTGCATCCAATGTGGAGGGCAAGGCCCAGAAAAACTACCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185   None 289 None 5
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34202334)
KASP Assay ID:
2261-4626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAATCCAGCAGGCACTGCCCTGGGGAAAACCAAACTCAGAGTTCAAG[G/A]TTAGGCTCCCTCATAGGCTGGGATGATTAAACATCTGTGAAAAAGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185   None 289 None 5
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34202334)
KASP Assay ID:
2261-4626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAATCCAGCAGGCACTGCCCWGGGGAAAACYAAACTCAGAGTTCAAG[G/A]TTAGGCTCMCTCATAGGCTGGGATGATTAAACATCTGTGRAARAGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4620 5616 89 107
ENSDART00000144705 Essential Splice Site 4538 5534 88 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34196538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCAAAGCGGTGGAGGCCATCATGTGTAGCATAAGACCATGCCCAGG[T/C]GAGTGGATAAACATATCTTCTTCTGCATATGCATATCAGCCTTTATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4734 5616 92 107
ENSDART00000144705 Essential Splice Site 4652 5534 91 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34195968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAATGGTATAATGAACCAAGCAAAAACTACAAATGATCTCTCTTCAT[A/T]GTTCATGGAAACTGGGGCCCATGGAACAGCTGGGGCAGTTGTAGCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4791 5616 92 107
ENSDART00000144705 Essential Splice Site 4709 5534 91 106
ENSDART00000148185   None 289 None 5
Genomic Location:
Chromosome 20 (position 34195794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGATCAGACTCACAAATCCAGAAGTGTAACACAGCCAACTGCCCTGG[T/C]AAAGCAGTCATGCTGTACAAACAATACCTTTTAAAAGTTTGAAGGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 5569 5616 107 107
ENSDART00000144705 Nonsense 5487 5534 106 106
ENSDART00000148185 Nonsense 242 289 5 5
Genomic Location:
Chromosome 20 (position 34183386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGACGAAGACACGACTCTGCCCTTCGCCCTCCGGGATGAAAACCTC[A/T]AAGGTGTTCTGTTCACCACCCGGCCACTGCGCGAGCCTCACACATACCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link