hmcn1

Ensembl ID:
ENSDARG00000016936
ZFIN ID:
ZDB-GENE-041014-322
Description:
hemicentin 1 [Source:RefSeq peptide;Acc:NP_001177233]
Human Orthologue:
HMCN1
Human Description:
hemicentin 1 [Source:HGNC Symbol;Acc:19194]
Mouse Orthologue:
Hmcn1
Mouse Description:
hemicentin 1 Gene [Source:MGI Symbol;Acc:MGI:2685047]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9806 Essential Splice Site Available for shipment Available now
sa23757 Nonsense Mutation detected in F1 DNA During 2014
sa16438 Nonsense Available for shipment Available now
sa17994 Nonsense Available for shipment Available now
sa4918 Nonsense Mutation detected in F1 DNA During 2014
sa19239 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11019 Essential Splice Site Available for shipment Available now
sa23756 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 1164 5616 24 107
ENSDART00000144705 Essential Splice Site 1081 5534 23 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34244512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTCRGCTTTCKCAMTTTTATTAATACTCCTTTCTCTTTWTTTTGCA[G/A]TTCSTCCCAGCATCMGTGCAGGTCCCCGAGCCATRAAAGTGCAGATCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 1608 5616 31 107
ENSDART00000144705 Nonsense 1525 5534 30 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34237266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGGGCAGTTCCTCAAGATCTTAAGAGCTCAAGTTTCTGATGCTGGA[C/T]AGTACACATGTAGAGTCACCAGTGTGGCTGGCACTGCTGAAAAAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2698 5616 52 107
ENSDART00000144705 Nonsense 2617 5534 51 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34218338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGCYGGAGTGTGAAGCTCAAGCTATCCCAAYACCGACACTAGTGTGGTA[C/A]AAGGATGGTCAGGTGAGAAWTGCACAAAACTCWRAATATTTTNCTCCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 2846 5616 55 107
ENSDART00000144705 Nonsense 2765 5534 54 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34216299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACACATGTGTRGCTGTGAATGAGGCTGGTGAAGACTCAATCCAGTA[T/A]GATGTCAGAGTGTTGTGTGAGTATATTGTTTTGTACATGCTAAACATSAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Nonsense 3181 5616 63 107
ENSDART00000144705 Nonsense 3100 5534 62 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34211191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCAAAATATGTCTAATGCTTGTTTTGATTGTCTTTGTAGAAAAYTCA[G/T]AGTCTCTAGAGATGCATATCCTGTCTGGGGGCAGTAAGCTGCAGATTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185 None None 289 None 5
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34202334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAATCCAGCAGGCACTGCCCTGGGGAAAACCAAACTCAGAGTTCAAG[G/A]TTAGGCTCCCTCATAGGCTGGGATGATTAAACATCTGTGAAAAAGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185 None None 289 None 5
ENSDART00000020389 Essential Splice Site 4061 5616 80 107
ENSDART00000144705 Essential Splice Site 3980 5534 79 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34202334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAATCCAGCAGGCACTGCCCWGGGGAAAACYAAACTCAGAGTTCAAG[G/A]TTAGGCTCMCTCATAGGCTGGGATGATTAAACATCTGTGRAARAGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020389 Essential Splice Site 4620 5616 89 107
ENSDART00000144705 Essential Splice Site 4538 5534 88 106
ENSDART00000148185 None None 289 None 5
Genomic Location:
Chromosome 20 (position 34196538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCAAAGCGGTGGAGGCCATCATGTGTAGCATAAGACCATGCCCAGG[T/C]GAGTGGATAAACATATCTTCTTCTGCATATGCATATCAGCCTTTATCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v17pi1bm