ttyh2

Ensembl ID:
ENSDARG00000016934
ZFIN ID:
ZDB-GENE-040718-193
Description:
tweety homolog 2 [Source:RefSeq peptide;Acc:NP_001002490]
Human Orthologue:
TTYH2
Human Description:
tweety homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:13877]
Mouse Orthologue:
Ttyh2
Mouse Description:
tweety homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2157091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16459 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009172 Nonsense 238 535 5 14
ENSDART00000081046 Nonsense 238 316 5 8
ENSDART00000134670 Nonsense 238 483 5 12
Genomic Location:
Chromosome 12 (position 40198575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTTGGATCTGATCATCTGTCTTGCTGCTTGTCTGGGTCTGGCCAAA[C/T]AATCTCGMTGGTTGCTGACTACGTGAGTACAAACCTTSAGTACATCTMAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u47mxrlc