ttyh2

Ensembl ID:
ENSDARG00000016934
ZFIN ID:
ZDB-GENE-040718-193
Description:
tweety homolog 2 [Source:RefSeq peptide;Acc:NP_001002490]
Human Orthologue:
TTYH2
Human Description:
tweety homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:13877]
Mouse Orthologue:
Ttyh2
Mouse Description:
tweety homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2157091]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38903 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16459 Nonsense Available for shipment Available now
sa35361 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009172 Essential Splice Site 102 535 2 14
ENSDART00000081046 Essential Splice Site 102 316 2 8
ENSDART00000134670 Essential Splice Site 102 483 2 12
Genomic Location:
Chromosome 12 (position 40148327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTTGCTGTGTGACTTGGGCTGCTGTTGCTGCCGGGCTCATCTGCTGG[T/A]ACGTACCACCCACCGTTCACATGCTGAGAGGATAAACCTGCTCAAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009172 Nonsense 238 535 5 14
ENSDART00000081046 Nonsense 238 316 5 8
ENSDART00000134670 Nonsense 238 483 5 12
Genomic Location:
Chromosome 12 (position 40198575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTTGGATCTGATCATCTGTCTTGCTGCTTGTCTGGGTCTGGCCAAA[C/T]AATCTCGMTGGTTGCTGACTACGTGAGTACAAACCTTSAGTACATCTMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009172 Nonsense 303 535 8 14
ENSDART00000081046 Nonsense 303 316 8 8
ENSDART00000134670 Nonsense 303 483 8 12
Genomic Location:
Chromosome 12 (position 40215732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTGTTCTTGTTTTCTAGATATCGTCCATTATTACCTGTACTGCAGC[C/T]AGACTCTCCCAAACCCCTTTCAGCAGGTACTATGTTCAATATAAATGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link