ENSDARG00000016923

Ensembl ID:
ENSDARG00000016923
Human Orthologue:
RIC8A
Human Description:
resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) [Source:HGNC Symbol;Acc:29550]
Mouse Orthologue:
Ric8
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10218 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002233 Nonsense 350 543 9 12
Genomic Location:
Chromosome 12 (position 5405523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGAAGGAGAGACTGACCCCAGTGCTGAACYTGCTGGCCGAATGCTCC[A/T]GAGCTCACAGAGACACCAGACTCTACCTCAGACAACAGGCATGSCCACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3odts85a