ace2

Ensembl ID:
ENSDARG00000016918
ZFIN ID:
ZDB-GENE-041114-6
Description:
angiotensin-converting enzyme 2 [Source:RefSeq peptide;Acc:NP_001007298]
Human Orthologue:
ACE2
Human Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 [Source:HGNC Symbol;Acc:13557]
Mouse Orthologue:
Ace2
Mouse Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 Gene [Source:MGI Symbol;Acc:MGI:1917258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1003 Nonsense Available for shipment Available now
sa10138 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003712 Nonsense 5 785 1 18
ENSDART00000126110 Nonsense 5 785 1 18
Genomic Location:
Chromosome 11 (position 30871772)
KASP Assay ID:
554-0907.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAGCGTCAGAATCGGTGGGACAAGGCTGTGGTCATGTGTGCTCGCT[G/A]GCTCCTGCTTTTGGCCTTGGCCTCTGTGGCCTGCTGTCAGACTGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003712 Essential Splice Site 115 785 3 18
ENSDART00000126110 Essential Splice Site 115 785 3 18
Genomic Location:
Chromosome 11 (position 30869304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATGACAAACATAGAAACTAAAATKGTGTGAATGACTTRTGTATCACA[G/A]CTGAGAAATATCATGTCAGAGATGAGCACTATTTACAACACGGCRACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t16dxokl