ace2

Ensembl ID:
ENSDARG00000016918
ZFIN ID:
ZDB-GENE-041114-6
Description:
angiotensin-converting enzyme 2 [Source:RefSeq peptide;Acc:NP_001007298]
Human Orthologue:
ACE2
Human Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 [Source:HGNC Symbol;Acc:13557]
Mouse Orthologue:
Ace2
Mouse Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 Gene [Source:MGI Symbol;Acc:MGI:1917258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1003 Nonsense Available for shipment Available now
sa10138 Essential Splice Site Available for shipment Available now
sa41865 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003712 Nonsense 5 785 1 18
ENSDART00000126110 Nonsense 5 785 1 18
Genomic Location (Zv9):
Chromosome 11 (position 30871772)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29749134
KASP Assay ID:
554-0907.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAGCGTCAGAATCGGTGGGACAAGGCTGTGGTCATGTGTGCTCGCT[G/A]GCTCCTGCTTTTGGCCTTGGCCTCTGTGGCCTGCTGTCAGACTGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003712 Essential Splice Site 115 785 3 18
ENSDART00000126110 Essential Splice Site 115 785 3 18
Genomic Location (Zv9):
Chromosome 11 (position 30869304)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29746666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATGACAAACATAGAAACTAAAATKGTGTGAATGACTTRTGTATCACA[G/A]CTGAGAAATATCATGTCAGAGATGAGCACTATTTACAACACGGCRACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003712 Nonsense 529 785 12 18
ENSDART00000126110 Nonsense 529 785 12 18
Genomic Location (Zv9):
Chromosome 11 (position 30860853)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29738215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTACTTCACTAGAACCATATATCAGTTCCAGTTTCAAGAGGCATTATG[T/A]AAGGCAGCTGGCCACACCGGTCCCCTTTACAAATGTGACATTACAAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link