bckdk

Ensembl ID:
ENSDARG00000016904
ZFIN ID:
ZDB-GENE-021204-1
Description:
[Source:RefSeq peptide;Acc:NP_998225]
Human Orthologue:
BCKDK
Human Description:
branched chain ketoacid dehydrogenase kinase [Source:HGNC Symbol;Acc:16902]
Mouse Orthologue:
Bckdk
Mouse Description:
branched chain ketoacid dehydrogenase kinase Gene [Source:MGI Symbol;Acc:MGI:1276121]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38517 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023676 Nonsense 186 428 5 11
Genomic Location (Zv9):
Chromosome 5 (position 64588887)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60841547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGATGGTAAAACAGCTTCTTGATGATCACAAGGATGTTGTCACCATGT[T/A]AGCTGAAGGATTCAGGGAATGTCGTAAACACATATTGGTGAGATTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link