gys1

Ensembl ID:
ENSDARG00000016875
ZFIN ID:
ZDB-GENE-040426-1243
Description:
glycogen synthase 1 (muscle) [Source:RefSeq peptide;Acc:NP_957474]
Human Orthologue:
GYS1
Human Description:
glycogen synthase 1 (muscle) [Source:HGNC Symbol;Acc:4706]
Mouse Orthologue:
Gys1
Mouse Description:
glycogen synthase 1, muscle Gene [Source:MGI Symbol;Acc:MGI:101805]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26025 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008711 Essential Splice Site 517 700 12 16
ENSDART00000043945 Essential Splice Site 517 700 11 15

The following transcripts of ENSDARG00000016875 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 16361895)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16592114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTGGAGTATTTCCCTCTTACTATGAGCCCTGGGGATACACACCAGG[T/C]AAAACTACACTATTTTGTTTTGTTTTTATTTTATTTTACTTGTATTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link