rhobtb2a

Ensembl ID:
ENSDARG00000016868
ZFIN ID:
ZDB-GENE-060315-11
Description:
Rho-related BTB domain containing 2a [Source:RefSeq peptide;Acc:NP_001093444]
Human Orthologue:
RHOBTB1
Human Description:
Rho-related BTB domain containing 1 [Source:HGNC Symbol;Acc:18738]
Mouse Orthologue:
Rhobtb1
Mouse Description:
Rho-related BTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916538]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26551 Nonsense Mutation detected in F1 DNA During 2016
sa15510 Nonsense Available for shipment Available now
sa40537 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051114 Nonsense 16 709 1 11
ENSDART00000111587 Nonsense 9 716 1 10
Genomic Location:
Chromosome 5 (position 45089150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCATCTCTTGTAGGGCCCTCTCCATGGATATAGACACAGATTATGAG[C/T]GACCTAATGTGGAGACCATAAAGTGTGTGGTGGTGGGTGATAACGCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051114 Nonsense 434 709 6 11
ENSDART00000111587 Nonsense 435 716 5 10
Genomic Location:
Chromosome 5 (position 45098354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGATTGTCTCCTCTTTTGGCTYTTTCAGGCAGTGCTGCAGTACCTTTA[C/A]ACTGGTCATCTGGATGAGAGACGTGGGGACCTRAWGCAGGTGGCCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051114 Splice Site, Nonsense 592 709 9 11
ENSDART00000111587 Splice Site, Nonsense 593 716 8 10
Genomic Location:
Chromosome 5 (position 45117611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGATATATTAACACTTGTTGTGTGGTGTTTTGTCATGGTCTACAGAG[C/T]AACACGCCGTTGAGGATCTGTTGCAGTTGTCCGTTAAAGGGTTGGACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link