rhobtb2a

Ensembl ID:
ENSDARG00000016868
ZFIN ID:
ZDB-GENE-060315-11
Description:
Rho-related BTB domain containing 2a [Source:RefSeq peptide;Acc:NP_001093444]
Human Orthologue:
RHOBTB1
Human Description:
Rho-related BTB domain containing 1 [Source:HGNC Symbol;Acc:18738]
Mouse Orthologue:
Rhobtb1
Mouse Description:
Rho-related BTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916538]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26551 Nonsense Mutation detected in F1 DNA During 2015
sa15510 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051114 Nonsense 16 709 1 11
ENSDART00000111587 Nonsense 9 716 1 10
Genomic Location:
Chromosome 5 (position 45089150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCATCTCTTGTAGGGCCCTCTCCATGGATATAGACACAGATTATGAG[C/T]GACCTAATGTGGAGACCATAAAGTGTGTGGTGGTGGGTGATAACGCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051114 Nonsense 434 709 6 11
ENSDART00000111587 Nonsense 435 716 5 10
Genomic Location:
Chromosome 5 (position 45098354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGATTGTCTCCTCTTTTGGCTYTTTCAGGCAGTGCTGCAGTACCTTTA[C/A]ACTGGTCATCTGGATGAGAGACGTGGGGACCTRAWGCAGGTGGCCACCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w9y7kf5e